← Back to search

11gi

Human Argonaute2 WT - guide(3 prime-amino) RNA in complex with a fully complementary target

Method: ELECTRON MICROSCOPY D_max: 96.4 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	11gi
deposition_date	2026-02-23
title	Human Argonaute2 WT - guide(3 prime-amino) RNA in complex with a fully complementary target
keywords	RNA binding protein, RNP, RNA, Argonaute2, Ago2, RNA BINDING PROTEIN-RNA complex; RNA BINDING PROTEIN/RNA
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	28.44 Å
rg_electron	28.49 Å
i0	157345000.00
molecular_weight	90621.0 kDa
excluded_volume	109600 Å³
envelope_volume	137980 Å³
shell_volume	39960 Å³
envelope_diameter	101.8 Å
shell_rg	36.15 Å
envelope_rg	28.63 Å
shape_rg	28.49 Å
total_rg	29.13 Å
total_atoms	6316
n_residues	725
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	96.4 Å
rg_real	28.43 Å
rg_real_error	0.83 Å
i0_real	1.5730e+08
i0_real_error	2.5170e+06
rg_reciprocal	28.44 Å
i0_reciprocal	157300000.0000
total_estimate	0.8629
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	34.4 Å
skewness	0.442
kurtosis	-0.046
angular_range	— – 0.2800 Å⁻¹
current_alpha	0.0000
highest_alpha	42070000.0000
n_real_points	57
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.749; Stabil: 0.998; Sysdev: 1.000; Positv: 1.000; Valcen: 0.993; Smooth: 0.979

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (5)

Entity 1 polymer

description	Argonaute2 WT
formula_weight	97402.2 kDa
ec_number	3.1.26.-
mutation	S387D, S824A, S828D, S831D, S834A
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	A
atom_count	6318

MYSGAGPALAPPAPPPPIQGYAFKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSADFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDAAEGDHTDGQANGRDHQALAKAVQVHQDTLRTMYFA

Source

organism	Homo sapiens
common_name	human
ncbi_taxonomy_id	9606
host_organism	Spodoptera frugiperda

Entity 2 polymer

description	guide(3 prime-amino) RNA
formula_weight	6481.9 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	B

UGGAGUGUGACAAUGGUGUU

Entity 3 polymer

description	target RNA
formula_weight	7258.4 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	C

AAACACCAUUGUCACACUCCAAA

Entity 4 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	1

Entity 5 water

description	water
formula_weight	18.0 kDa
src_method	nat
entity_count	2

▶

6. Citations (1)

▶

resolution	3.00 Å
resolution_method	—
num_particles	207140

fit	/app/data/saxs_computation/1g/11gi/11gi.fit
pddf	/app/data/pr_computation/1g/11gi/11gi.pr.out
profile	/app/data/saxs_computation/1g/11gi/11gi.dat

Human Argonaute2 WT - guide(3 prime-amino) RNA in complex with a fully complementary target

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

EM 3D

5. Entities & Polymer Info (5)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 polymer

Polymer

Entity 4 non-polymer

Entity 5 water

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)