← Back to search

11gk

Human Argonaute2 R315V/H316A - guide RNA in complex with a fully complementary target (conformation 2)

Method: ELECTRON MICROSCOPY D_max: 76.7 Å Quality: GOOD

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	11gk
deposition_date	2026-02-23
title	Human Argonaute2 R315V/H316A - guide RNA in complex with a fully complementary target (conformation 2)
keywords	RNA binding protein, RNP, RNA, Argonaute2, Ago2, RNA BINDING PROTEIN-RNA complex; RNA BINDING PROTEIN/RNA
method	ELECTRON MICROSCOPY

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	24.13 Å
rg_electron	22.93 Å
i0	66374700.00
molecular_weight	55848.0 kDa
excluded_volume	66538 Å³
envelope_volume	82650 Å³
shell_volume	29430 Å³
envelope_diameter	78.9 Å
shell_rg	30.58 Å
envelope_rg	23.01 Å
shape_rg	22.89 Å
total_rg	23.80 Å
total_atoms	3878
n_residues	426
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	76.7 Å
rg_real	24.00 Å
rg_real_error	0.37 Å
i0_real	6.6370e+07
i0_real_error	8.7030e+05
rg_reciprocal	24.03 Å
i0_reciprocal	66380000.0000
total_estimate	0.8957
solution_quality	GOOD a GOOD solution
n_peaks	2
r_peak_primary	31.2 Å
skewness	0.202
kurtosis	-0.350
angular_range	— – 0.3300 Å⁻¹
current_alpha	0.0000
highest_alpha	9754000.0000
n_real_points	65
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.884; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.996; Smooth: 0.993

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (4)

Entity 1 polymer

description	Argonaute-2 R315V/H316A
formula_weight	97277.1 kDa
ec_number	3.1.26.-
mutation	R315V, H316A, S387D, S824A, S828D, S831D, S834A
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	A
atom_count	3878

MYSGAGPALAPPAPPPPIQGYAFKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDVAKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSADFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDAAEGDHTDGQANGRDHQALAKAVQVHQDTLRTMYFA

Source

organism	Homo sapiens
common_name	human
ncbi_taxonomy_id	9606
host_organism	Spodoptera frugiperda

Entity 2 polymer

description	guide RNA
formula_weight	6481.9 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	B

UGGAGUGUGACAAUGGUGUU

Entity 3 polymer

description	target RNA
formula_weight	7258.4 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	C

AAACACCAUUGUCACACUCCAAA

Entity 4 non-polymer

description	MAGNESIUM ION
formula_weight	24.3 kDa
src_method	syn
entity_count	1

▶

6. Citations (1)

▶

length_a	1.000 Å
length_b	1.000 Å
length_c	1.000 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	90.00 °
z_pdb	—

space_group	P 1
int_tables_number	1
crystal_system	—

resolution	3.00 Å
resolution_method	—
num_particles	242799

fit	/app/data/saxs_computation/1g/11gk/11gk.fit
pddf	/app/data/pr_computation/1g/11gk/11gk.pr.out
profile	/app/data/saxs_computation/1g/11gk/11gk.dat

Human Argonaute2 R315V/H316A - guide RNA in complex with a fully complementary target (conformation 2)

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

EM 3D

5. Entities & Polymer Info (4)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 polymer

Polymer

Entity 4 non-polymer

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)