SAXSdb — 1h3e

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

TYROSYL-TRNA SYNTHETASE

THERMUS THERMOPHILUS

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 2 RNA 2	WILD-TYPE TRNATYR(GUA) × 2 ADENOSINE-5'-TRIPHOSPHATE × 2 4-[(2S)-2-amino-3-hydroxypropyl]phenol × 2 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYY_THETH
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–432； UniProt 1–432

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1h3e
Deposition date deposition_date	2002-08-28
Structure title title	Tyrosyl-tRNA synthetase from Thermus thermophilus complexed with wild-type tRNAtyr(GUA) and with ATP and tyrosinol
Keywords keywords	LIGASE, CLASS I AMINOACYL-TRNA SYNTHETASE: ATP + L-TYROSINE + TRNA(TYR) -> AMP + PPI + L-TYROSYL-TRNA(TYR); LIGASE
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1h3e__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1h3e__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1h3e__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	40.14 Å
Rg (electron density)	40.05 Å
Total Rg	40.23 Å
Atom count	10416
Residues	1014
Excluded volume	173030 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1h3e__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	TYROSYL-TRNA SYNTHETASE
Molecular weight formula_weight	48786.2 kDa
EC 编号 ec_number	6.1.1.1
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	5221

MAGTGHTPEEALALLKRGAEEIVPEEELLAKLKEGRPLTVKLGADPTRPDLHLGHAVVLRKMRQFQELGHKVVLIIGDFTGMIGDPSGRSKTRPPLTLEETRENAKTYVAQAGKILRQEPHLFELRYNSEWLEGLTFKEVVRLTSLMTVAQMLEREDFKKRYEAGIPISLHELLYPFAQAYDSVAIRADVEMGGTDQRFNLLVGREVQRAYGQSPQVCFLMPLLVGLDGREKMSKSLDNYIGLTEPPEAMFKKLMRVPDPLLPSYFRLLTDLEEEEIEALLKAGPVPAHRVLARLLTAAYALPQIPPRIDRAFYESLGYAWEAFGRDKEAGPEEVRRAEARYDEVAKGGIPEEIPEVTIPASELKEGRIWVARLFTLAGLTPSNAEARRLIQNRGLRLDGEVLTDPMLQVDLSRPRILQRGKDRFVRVRLSD

Source Source

Source organism organism	THERMUS THERMOPHILUS
NCBI taxonomy ID ncbi_taxonomy_id	262724
Host organism host_organism	ESCHERICHIA COLI

Entity 2 Entity 2 polymer

Description description	WILD-TYPE TRNATYR(GUA)
Molecular weight formula_weight	27709.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	B

GGGCAGGUUCCCGAGCGGCCAAAGGGGACGGUCUGUAAAACCGUUGGCGUAUGCCUUCGCUGGUUCGAAUCCAGCCCUGCCCACCA

Entity 3 Entity 3 non-polymer

Description description	ADENOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	507.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	4-[(2S)-2-amino-3-hydroxypropyl]phenol
Molecular weight formula_weight	167.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	13

▼

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (2 domains)

Domain ID domain_id	d1h3ea1
Class class	c — Alpha and beta proteins (a/b)
Fold Fold fold	c.26 — Adenine nucleotide alpha hydrolase-like
Superfamily Superfamily superfamily	c.26.1 — Nucleotidylyl transferase
Family Family family	c.26.1.1 — Class I aminoacyl-tRNA synthetases (RS), catalytic domain

Domain ID domain_id	d1h3ea2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.66 — Alpha-L RNA-binding motif
Superfamily Superfamily superfamily	d.66.1 — Alpha-L RNA-binding motif
Family Family family	d.66.1.4 — Tyrosyl-tRNA synthetase (TyrRS), C-terminal domain

CATH v4.4 (3 domains)

Domain ID domain_id	1h3eA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	620 — HUPs

Domain ID domain_id	1h3eA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	240 — Tyrosyl-Transfer RNA Synthetase
Homologous superfamily homologous superfamily	10 — Tyrosyl-Transfer RNA Synthetase

Domain ID domain_id	1h3eA03
Class class	3 — Alpha Beta
Architecture architecture	10 — Roll
Topology topology	290 — Structural Genomics Hypothetical 15.5 Kd Protein In mrcA-pckA Intergenic Region; Chain A
Homologous superfamily homologous superfamily	10 — RNA-binding S4 domain

▶

Unit-cell length a length_a	129.525 Å
Unit-cell length b length_b	129.525 Å
Unit-cell length c length_c	109.451 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 31 2 1
Space-group number int_tables_number	152
Crystal system crystal_system	—

Resolution resolution	2.900 Å
Low-resolution limit resolution_low	22.990 Å
R factor r_factor	0.2190
R_work r_work	0.2190
R_free r_free	0.2690

Tyrosyl-tRNA synthetase from Thermus thermophilus complexed with wild-type tRNAtyr(GUA) and with ATP and tyrosinol

1. Protein Identity and Related Structures Protein Identity & Related Structures

TYROSYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1h3e__assembly_1__model_1

1h3e__assembly_1__model_1 | I(q)

1h3e__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (2 domains)

CATH v4.4 (3 domains)

7. Citations (1)

Tyrosyl-tRNA synthetase from Thermus thermophilus complexed with wild-type tRNAtyr(GUA) and with ATP and tyrosinol

1. Protein Identity and Related Structures Protein Identity & Related Structures

TYROSYL-TRNA SYNTHETASE

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1h3e__assembly_1__model_1

1h3e__assembly_1__model_1 | I(q)

1h3e__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (2 domains)

CATH v4.4 (3 domains)

7. Citations (1)