← Back to search

9sfb

;Structure at 2.7 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to a tRNA(Tyr)(GUA) transcript, the sulphamoyl analogue of tyrosyl-adenylate and pyrophosphate. ;

Method: X-RAY DIFFRACTION D_max: 89.2 Å Quality: EXCELLENT

SAXS Profile

P(r) Distribution

▼

1. Structure Basics

entry_id	9sfb
deposition_date	2025-08-19
last_revision	2025-09-03
title	;Structure at 2.7 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to a tRNA(Tyr)(GUA) transcript, the sulphamoyl analogue of tyrosyl-adenylate and pyrophosphate. ;
keywords	aminoacyl-tRNA synthetase, ligase, tRNA, RNA BINDING PROTEIN; RNA BINDING PROTEIN
method	X-RAY DIFFRACTION

▼

Download Data

SAXS curve (.dat) P(r) distribution (.pr.out) Structure (CIF)

▼

2. SAXS Parameters (CRYSOL)

rg_guinier	29.49 Å
rg_electron	28.75 Å
i0	148097000.00
molecular_weight	76071.0 kDa
excluded_volume	86521 Å³
envelope_volume	118410 Å³
shell_volume	34322 Å³
envelope_diameter	95.0 Å
shell_rg	36.06 Å
envelope_rg	28.30 Å
shape_rg	28.71 Å
total_rg	29.41 Å
total_atoms	5220
n_residues	510
n_harmonics	20
q_range	— – 0.5000 Å⁻¹
n_points	101
shell_type	directional
solvent_density	0.3340 e/Å³
contrast_shell	0.0300 e/Å³
crysol_version	4.1.3

▼

3. P(r) Analysis (GNOM)

dmax	89.2 Å
rg_real	29.40 Å
rg_real_error	0.70 Å
i0_real	1.4810e+08
i0_real_error	2.2350e+06
rg_reciprocal	29.44 Å
i0_reciprocal	148100000.0000
total_estimate	0.9156
solution_quality	EXCELLENT a EXCELLENT solution
n_peaks	2
r_peak_primary	38.0 Å
skewness	0.160
kurtosis	-0.602
angular_range	— – 0.2700 Å⁻¹
current_alpha	0.0000
highest_alpha	11080000.0000
n_real_points	55
gnom_version	4.1.3
quality_criteria	AN1: 0.000; Oscil: 0.981; Stabil: 0.999; Sysdev: 1.000; Positv: 1.000; Valcen: 1.000; Smooth: 0.959

▶

4. Crystallography & Experiment

▶

5. Entities & Polymer Info (5)

Entity 1 polymer

description	Tyrosine--tRNA ligase
formula_weight	48786.2 kDa
ec_number	6.1.1.1
src_method	man
entity_count	1

Polymer

type	polypeptide(L)
strand_id	A
atom_count	5231

MAGTGHTPEEALALLKRGAEEIVPEEELLAKLKEGRPLTVKLGADPTRPDLHLGHAVVLRKMRQFQELGHKVVLIIGDFTGMIGDPSGRSKTRPPLTLEETRENAKTYVAQAGKILRQEPHLFELRYNSEWLEGLTFKEVVRLTSLMTVAQMLEREDFKKRYEAGIPISLHELLYPFAQAYDSVAIRADVEMGGTDQRFNLLVGREVQRAYGQSPQVCFLMPLLVGLDGREKMSKSLDNYIGLTEPPEAMFKKLMRVPDPLLPSYFRLLTDLEEEEIEALLKAGPVPAHRVLARLLTAAYALPQIPPRIDRAFYESLGYAWEAFGRDKEAGPEEVRRAEARYDEVAKGGIPEEIPEVTIPASELKEGRIWVARLFTLAGLTPSNAEARRLIQNRGLRLDGEVLTDPMLQVDLSRPRILQRGKDRFVRVRLSD

Source

organism	Thermus thermophilus HB27
ncbi_taxonomy_id	262724
host_organism	Escherichia coli BL21(DE3)

Entity 2 polymer

description	Thermus thermophilus tRNATyr(GUC) transcript
formula_weight	27681.5 kDa
src_method	syn
entity_count	1

Polymer

type	polyribonucleotide
strand_id	T

GGGCAGGUUCCCGAGCGGCCAAAGGGGACGGUCUGUAAAACCGUUGGCGUAUGCCUUCGCUGGUUCGAAUCCAGCCCUGCCCACCA

Entity 3 non-polymer

description	PYROPHOSPHATE
formula_weight	178.0 kDa
src_method	syn
entity_count	1

Entity 4 non-polymer

description	SULFATE ION
formula_weight	96.1 kDa
src_method	syn
entity_count	6

Entity 5 non-polymer

description	5'-O-[N-(L-TYROSYL)SULFAMOYL]ADENOSINE
formula_weight	509.5 kDa
src_method	syn
entity_count	1

▶

6. Citations (1)

▶

length_a	130.629 Å
length_b	130.629 Å
length_c	109.086 Å
angle_alpha	90.00 °
angle_beta	90.00 °
angle_gamma	120.00 °
z_pdb	6

space_group	P 31 2 1
int_tables_number	152
crystal_system	—

resolution	2.700 Å
resolution_low	23.000 Å
r_factor	—
r_work	0.2042
r_free	0.2479

fit	/app/data/saxs_computation/sf/9sfb/9sfb.fit
pddf	/app/data/pr_computation/sf/9sfb/9sfb.pr.out
profile	/app/data/saxs_computation/sf/9sfb/9sfb.dat

;Structure at 2.7 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to a tRNA(Tyr)(GUA) transcript, the sulphamoyl analogue of tyrosyl-adenylate and pyrophosphate. ;

SAXS Profile

P(r) Distribution

1. Structure Basics

Download Data

2. SAXS Parameters (CRYSOL)

3. P(r) Analysis (GNOM)

4. Crystallography & Experiment

Unit Cell

Symmetry

Refinement

Diffraction

5. Entities & Polymer Info (5)

Entity 1 polymer

Polymer

Source

Entity 2 polymer

Polymer

Entity 3 non-polymer

Entity 4 non-polymer

Entity 5 non-polymer

6. Citations (1)

7. Files & Curves (10)

Files (7)

Curves (3)