SAXSdb — 9sfb

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tyrosine--tRNA ligase

Thermus thermophilus HB27

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Monomer	Protein 1 RNA 1	Thermus thermophilus tRNATyr(GUC) transcript × 1 PYROPHOSPHATE × 1 SULFATE ION × 6 5'-O-[N-(L-TYROSYL)SULFAMOYL]ADENOSINE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYY_THET2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–432； UniProt 1–432

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9sfb
Deposition date deposition_date	2025-08-19
Last revision last_revision	2025-09-03
Structure title title	Structure at 2.7 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to a tRNA(Tyr)(GUA) transcript, the sulphamoyl analogue of tyrosyl-adenylate and pyrophosphate.
Keywords keywords	aminoacyl-tRNA synthetase, ligase, tRNA, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9sfb__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9sfb__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9sfb__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	29.49 Å
Rg (electron density)	28.75 Å
Total Rg	29.41 Å
Atom count	5220
Residues	510
Excluded volume	86521 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9sfb__assembly_1__model_1`	dimeric （2）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Tyrosine--tRNA ligase
Molecular weight formula_weight	48786.2 kDa
EC 编号 ec_number	6.1.1.1
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	5231

MAGTGHTPEEALALLKRGAEEIVPEEELLAKLKEGRPLTVKLGADPTRPDLHLGHAVVLRKMRQFQELGHKVVLIIGDFTGMIGDPSGRSKTRPPLTLEETRENAKTYVAQAGKILRQEPHLFELRYNSEWLEGLTFKEVVRLTSLMTVAQMLEREDFKKRYEAGIPISLHELLYPFAQAYDSVAIRADVEMGGTDQRFNLLVGREVQRAYGQSPQVCFLMPLLVGLDGREKMSKSLDNYIGLTEPPEAMFKKLMRVPDPLLPSYFRLLTDLEEEEIEALLKAGPVPAHRVLARLLTAAYALPQIPPRIDRAFYESLGYAWEAFGRDKEAGPEEVRRAEARYDEVAKGGIPEEIPEVTIPASELKEGRIWVARLFTLAGLTPSNAEARRLIQNRGLRLDGEVLTDPMLQVDLSRPRILQRGKDRFVRVRLSD

Source Source

Source organism organism	Thermus thermophilus HB27
NCBI taxonomy ID ncbi_taxonomy_id	262724
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	Thermus thermophilus tRNATyr(GUC) transcript
Molecular weight formula_weight	27681.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	T

GGGCAGGUUCCCGAGCGGCCAAAGGGGACGGUCUGUAAAACCGUUGGCGUAUGCCUUCGCUGGUUCGAAUCCAGCCCUGCCCACCA

Entity 3 Entity 3 non-polymer

Description description	PYROPHOSPHATE
Molecular weight formula_weight	178.0 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	6

Entity 5 Entity 5 non-polymer

Description description	5'-O-[N-(L-TYROSYL)SULFAMOYL]ADENOSINE
Molecular weight formula_weight	509.5 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	130.629 Å
Unit-cell length b length_b	130.629 Å
Unit-cell length c length_c	109.086 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 31 2 1
Space-group number int_tables_number	152
Crystal system crystal_system	—

Resolution resolution	2.700 Å
Low-resolution limit resolution_low	23.000 Å
R factor r_factor	—
R_work r_work	0.2042
R_free r_free	0.2479

Structure at 2.7 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to a tRNA(Tyr)(GUA) transcript, the sulphamoyl analogue of tyrosyl-adenylate and pyrophosphate.

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tyrosine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9sfb__assembly_1__model_1

9sfb__assembly_1__model_1 | I(q)

9sfb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)

Structure at 2.7 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to a tRNA(Tyr)(GUA) transcript, the sulphamoyl analogue of tyrosyl-adenylate and pyrophosphate.

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tyrosine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9sfb__assembly_1__model_1

9sfb__assembly_1__model_1 | I(q)

9sfb__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)