9sdf

Structure at 1.9 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to wild-type modified tRNA(Tyr), tyrosine and AMP

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tyrosine--tRNA ligase

Thermus thermophilus HB27

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 2 RNA 2	Thermus thermophilus tRNA(Tyr)(GUA) (86-MER) × 2 ADENOSINE MONOPHOSPHATE × 2 TYROSINE × 2 DI(HYDROXYETHYL)ETHER × 10 SULFATE ION × 4 PENTAETHYLENE GLYCOL × 10 TRIETHYLENE GLYCOL × 2 MAGNESIUM ION × 2 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SYY_THET2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–432； UniProt 1–432

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9sdf
Deposition date deposition_date	2025-08-13
Structure title title	Structure at 1.9 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to wild-type modified tRNA(Tyr), tyrosine and AMP
Keywords keywords	aminoacyl-tRNA synthetase, ligase, tRNA, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9sdf__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9sdf__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9sdf__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	40.39 Å
Rg (electron density)	40.43 Å
Total Rg	40.59 Å
Atom count	19828
Residues	1012
Excluded volume	179690 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9sdf__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (10)

Entity 1 Entity 1 polymer

Description description	Tyrosine--tRNA ligase
Molecular weight formula_weight	48786.2 kDa
EC 编号 ec_number	6.1.1.1
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	10714

MAGTGHTPEEALALLKRGAEEIVPEEELLAKLKEGRPLTVKLGADPTRPDLHLGHAVVLRKMRQFQELGHKVVLIIGDFTGMIGDPSGRSKTRPPLTLEETRENAKTYVAQAGKILRQEPHLFELRYNSEWLEGLTFKEVVRLTSLMTVAQMLEREDFKKRYEAGIPISLHELLYPFAQAYDSVAIRADVEMGGTDQRFNLLVGREVQRAYGQSPQVCFLMPLLVGLDGREKMSKSLDNYIGLTEPPEAMFKKLMRVPDPLLPSYFRLLTDLEEEEIEALLKAGPVPAHRVLARLLTAAYALPQIPPRIDRAFYESLGYAWEAFGRDKEAGPEEVRRAEARYDEVAKGGIPEEIPEVTIPASELKEGRIWVARLFTLAGLTPSNAEARRLIQNRGLRLDGEVLTDPMLQVDLSRPRILQRGKDRFVRVRLSD

Source Source

Source organism organism	Thermus thermophilus HB27
NCBI taxonomy ID ncbi_taxonomy_id	262724
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Thermus thermophilus tRNA(Tyr)(GUA) (86-MER)
Molecular weight formula_weight	27923.9 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	T

GGGCAGGUGCCCGAGUGGCCAAAGGGGACGGUCUGUAAAACCGUUGGCGUAUGCCUUCGCUGGUUCGAAUCCAGCCCUGCCCACCA

Entity 3 Entity 3 non-polymer

Description description	ADENOSINE MONOPHOSPHATE
Molecular weight formula_weight	347.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 4 Entity 4 non-polymer

Description description	TYROSINE
Molecular weight formula_weight	181.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	DI(HYDROXYETHYL)ETHER
Molecular weight formula_weight	106.1 kDa
Source method src_method	syn
Copy count entity_count	5

Entity 6 Entity 6 non-polymer

Description description	SULFATE ION
Molecular weight formula_weight	96.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 7 Entity 7 non-polymer

Description description	PENTAETHYLENE GLYCOL
Molecular weight formula_weight	238.3 kDa
Source method src_method	syn
Copy count entity_count	5

Entity 8 Entity 8 non-polymer

Description description	TRIETHYLENE GLYCOL
Molecular weight formula_weight	150.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 9 Entity 9 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 10 Entity 10 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	497

▶

Unit-cell length a length_a	125.067 Å
Unit-cell length b length_b	67.378 Å
Unit-cell length c length_c	113.817 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	112.25 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	1.900 Å
Low-resolution limit resolution_low	16.740 Å
R factor r_factor	0.1890
R_work r_work	0.1880
R_free r_free	0.2139

Structure at 1.9 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to wild-type modified tRNA(Tyr), tyrosine and AMP

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tyrosine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9sdf__assembly_1__model_1

9sdf__assembly_1__model_1 | I(q)

9sdf__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (10)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

Entity 10 Entity 10 water

7. Citations (1)

Structure at 1.9 A resolution of Thermus thermophilus tyrosyl-tRNA synthetase bound to wild-type modified tRNA(Tyr), tyrosine and AMP

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tyrosine--tRNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9sdf__assembly_1__model_1

9sdf__assembly_1__model_1 | I(q)

9sdf__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (10)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

Entity 10 Entity 10 water

7. Citations (1)