SAXSdb — 1ma7

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRE RECOMBINASE

Enterobacteria phage P1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 4	LOXP × 2 LOXP × 2 water × 8	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RECR_BPP1
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–349； UniProt 1–343 Author chain B； PDBConstruct 1–349； UniProt 1–343

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1ma7
Deposition date deposition_date	2002-08-01
Structure title title	Crystal structure of Cre site-specific recombinase complexed with a mutant DNA substrate, LoxP-A8/T27
Keywords keywords	;Cre-Lox site-specific recombination, Specificity of protein-DNA interactions, protein-DNA complex, Tyrosine recombinase, HYDROLASE, LIGASE-DNA COMPLEX ;; HYDROLASE, LIGASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1ma7__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1ma7__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1ma7__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	38.13 Å
Rg (electron density)	37.12 Å
Total Rg	37.56 Å
Atom count	12832
Residues	1412
Excluded volume	218930 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1ma7__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	LOXP
Molecular weight formula_weight	10469.8 kDa
Mutation mutation	C8A,G27T
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C
Atom count atom_count	6699

ATAACTTAGTATAATGTATGCTATACTAAGTTAT

Entity 2 Entity 2 polymer

Description description	LOXP
Molecular weight formula_weight	10438.8 kDa
Mutation mutation	C8A,G27T
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

ATAACTTAGTATAGCATACATTATACTAAGTTAT

Entity 3 Entity 3 polymer

Description description	CRE RECOMBINASE
Molecular weight formula_weight	39424.0 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

MHHHHHHSNLLTVHQNLPALPVDATSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLEDGD

Source Source

Source organism organism	Enterobacteria phage P1
NCBI taxonomy ID ncbi_taxonomy_id	10678
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	283

▼

6. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d1ma7a1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1ma7a2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

Domain ID domain_id	d1ma7b1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1ma7b2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

CATH v4.4 (4 domains)

Domain ID domain_id	1ma7A01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1ma7A02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	1ma7B01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1ma7B02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

▶

Unit-cell length a length_a	107.540 Å
Unit-cell length b length_b	122.240 Å
Unit-cell length c length_c	180.030 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	2.300 Å
Low-resolution limit resolution_low	5.000 Å
R factor r_factor	—
R_work r_work	0.2390
R_free r_free	0.2900

Crystal structure of Cre site-specific recombinase complexed with a mutant DNA substrate, LoxP-A8/T27

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRE RECOMBINASE

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1ma7__assembly_1__model_1

1ma7__assembly_1__model_1 | I(q)

1ma7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

CATH v4.4 (4 domains)

7. Citations (4)

Crystal structure of Cre site-specific recombinase complexed with a mutant DNA substrate, LoxP-A8/T27

1. Protein Identity and Related Structures Protein Identity & Related Structures

CRE RECOMBINASE

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1ma7__assembly_1__model_1

1ma7__assembly_1__model_1 | I(q)

1ma7__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

CATH v4.4 (4 domains)

7. Citations (4)