SAXSdb — 1xns

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Recombinase CRE

Enterobacteria phage P1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 4	loxP DNA × 2 loxP DNA × 2 water × 8	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RECR_BPP1
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–324； UniProt 20–343 Author chain B； PDBConstruct 1–324； UniProt 20–343

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1xns
Deposition date deposition_date	2004-10-05
Structure title title	Peptide trapped Holliday junction intermediate in Cre-loxP recombination
Keywords keywords	CRE Recombinase, holliday junction, recombination, complex (recombinase-DNA), peptide inhibitor, Hydrolase, Ligase-DNA COMPLEX; Hydrolase, Ligase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1xns__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1xns__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1xns__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.83 Å
Rg (electron density)	36.79 Å
Total Rg	37.25 Å
Atom count	13022
Residues	1426
Excluded volume	221790 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1xns__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	loxP DNA
Molecular weight formula_weight	10775.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C
Atom count atom_count	6807

TATAACTTCGTATAATGTATGCTATACGAAGTTAT

Entity 2 Entity 2 polymer

Description description	loxP DNA
Molecular weight formula_weight	10439.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

ATAACTTCGTATAGCATACATTATACGAAGTTAT

Entity 3 Entity 3 polymer

Description description	Recombinase CRE
Molecular weight formula_weight	36577.8 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLEDGD

Source Source

Source organism organism	Enterobacteria phage P1
NCBI taxonomy ID ncbi_taxonomy_id	10678
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	296

▼

6. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d1xnsa1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1xnsa2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

Domain ID domain_id	d1xnsb1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1xnsb2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

CATH v4.4 (4 domains)

Domain ID domain_id	1xnsA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	1xnsA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1xnsB01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	1xnsB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

▶

Unit-cell length a length_a	106.078 Å
Unit-cell length b length_b	121.529 Å
Unit-cell length c length_c	177.799 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	2.800 Å
Low-resolution limit resolution_low	47.670 Å
R factor r_factor	0.1996
R_work r_work	0.1963
R_free r_free	0.2654

Peptide trapped Holliday junction intermediate in Cre-loxP recombination

1. Protein Identity and Related Structures Protein Identity & Related Structures

Recombinase CRE

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1xns__assembly_1__model_1

1xns__assembly_1__model_1 | I(q)

1xns__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

CATH v4.4 (4 domains)

7. Citations (1)

Peptide trapped Holliday junction intermediate in Cre-loxP recombination

1. Protein Identity and Related Structures Protein Identity & Related Structures

Recombinase CRE

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1xns__assembly_1__model_1

1xns__assembly_1__model_1 | I(q)

1xns__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

CATH v4.4 (4 domains)

7. Citations (1)