1q3u

Crystal structure of a wild-type Cre recombinase-loxP synapse: pre-cleavage complex

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cre recombinase

Enterobacteria phage P1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 4	loxP DNA × 2 loxP DNA × 2 IODIDE ION × 2 MAGNESIUM ION × 10 water × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RECR_BPP1
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 5–347； UniProt 1–343 Author chain B； PDBConstruct 5–347； UniProt 1–343 Author chain E； PDBConstruct 5–347； UniProt 1–343 Author chain F； PDBConstruct 5–347； UniProt 1–343

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1q3u
Deposition date deposition_date	2003-08-01
Structure title title	Crystal structure of a wild-type Cre recombinase-loxP synapse: pre-cleavage complex
Keywords keywords	Cre; recombinase; DNA-protein complex; crystal, REPLICATION-DNA COMPLEX; REPLICATION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1q3u__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1q3u__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1q3u__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	38.43 Å
Rg (electron density)	37.18 Å
Total Rg	37.64 Å
Atom count	13296
Residues	1443
Excluded volume	226040 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1q3u__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	loxP DNA
Molecular weight formula_weight	11364.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,G
Atom count atom_count	13299

CGATAACUTCGTATAATGTATGCTATACGAAGTTATC

Entity 2 Entity 2 polymer

Description description	loxP DNA
Molecular weight formula_weight	11387.4 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D,H

GGATAACTTCGTATAGCATACATTATACGAAGTTATC

Entity 3 Entity 3 polymer

Description description	Cre recombinase
Molecular weight formula_weight	39066.7 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,E,F

FQVPMSNLLTVHQNLPALPVDATSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLEDGD

Source Source

Source organism organism	Enterobacteria phage P1
NCBI taxonomy ID ncbi_taxonomy_id	10678
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 non-polymer

Description description	IODIDE ION
Molecular weight formula_weight	126.9 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	10

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	3

▼

6. Fold Classification (SCOP + CATH) 16 domains

SCOP 2.08 (8 domains)

Domain ID domain_id	d1q3ua1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1q3ua2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

Domain ID domain_id	d1q3ub1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1q3ub2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

Domain ID domain_id	d1q3ue1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1q3ue2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

Domain ID domain_id	d1q3uf1
Class class	a — All alpha proteins
Fold Fold fold	a.60 — SAM domain-like
Superfamily Superfamily superfamily	a.60.9 — lambda integrase-like, N-terminal domain
Family Family family	a.60.9.1 — lambda integrase-like, N-terminal domain

Domain ID domain_id	d1q3uf2
Class class	d — Alpha and beta proteins (a+b)
Fold Fold fold	d.163 — DNA breaking-rejoining enzymes
Superfamily Superfamily superfamily	d.163.1 — DNA breaking-rejoining enzymes
Family Family family	d.163.1.1 — Lambda integrase-like, catalytic core

CATH v4.4 (8 domains)

Domain ID domain_id	1q3uA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1q3uA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	1q3uB01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1q3uB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	1q3uE01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1q3uE02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	1q3uF01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	1q3uF02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

▶

Unit-cell length a length_a	107.991 Å
Unit-cell length b length_b	161.064 Å
Unit-cell length c length_c	196.003 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	2.900 Å
Low-resolution limit resolution_low	20.030 Å
R factor r_factor	0.2230
R_work r_work	0.2230
R_free r_free	0.2440

Crystal structure of a wild-type Cre recombinase-loxP synapse: pre-cleavage complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cre recombinase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1q3u__assembly_1__model_1

1q3u__assembly_1__model_1 | I(q)

1q3u__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 16 domains

SCOP 2.08 (8 domains)

CATH v4.4 (8 domains)

7. Citations (1)

Crystal structure of a wild-type Cre recombinase-loxP synapse: pre-cleavage complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Cre recombinase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1q3u__assembly_1__model_1

1q3u__assembly_1__model_1 | I(q)

1q3u__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 16 domains

SCOP 2.08 (8 domains)

CATH v4.4 (8 domains)

7. Citations (1)