SAXSdb — 1s9k

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear factor of activated T-cells, cytoplasmic 2

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	Human IL-2 ARRE1 Promoter Element, Plus Strand × 1 Human IL-2 ARRE1 Promoter Element, Minus Strand × 1 Proto-oncogene protein c-fos × 1 （P01100） Transcription factor AP-1 × 1 （P05412）	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	NFAC2_HUMAN
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 1–280； UniProt 399–678

Proto-oncogene protein c-fos

Homo sapiens

UniProt P01100

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	Human IL-2 ARRE1 Promoter Element, Plus Strand × 1 Human IL-2 ARRE1 Promoter Element, Minus Strand × 1 Nuclear factor of activated T-cells, cytoplasmic 2 × 1 （Q13469） Transcription factor AP-1 × 1 （P05412）	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	FOS_HUMAN
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain D； PDBConstruct 1–53； UniProt 140–192

Transcription factor AP-1

Homo sapiens

UniProt P05412

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 2	Human IL-2 ARRE1 Promoter Element, Plus Strand × 1 Human IL-2 ARRE1 Promoter Element, Minus Strand × 1 Nuclear factor of activated T-cells, cytoplasmic 2 × 1 （Q13469） Proto-oncogene protein c-fos × 1 （P01100）	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	JUN_HUMAN
Isoform	—
PDB entities	5
Chains and sequence ranges	Author chain E； PDBConstruct 1–52； UniProt 257–308

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1s9k
Deposition date deposition_date	2004-02-04
Structure title title	Crystal Structure of Human NFAT1 and Fos-Jun on the IL-2 ARRE1 Site
Keywords keywords	;Beta Barrel, Protein-DNA Complex, Double Helix, Ternary, Complex, B-ZIP, Basic Leucine Zipper, Coiled Coil, TRANSCRIPTION-DNA COMPLEX ;; TRANSCRIPTION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

1s9k__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

1s9k__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

1s9k__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	27.00 Å
Rg (electron density)	26.09 Å
Total Rg	26.87 Å
Atom count	3887
Residues	425
Excluded volume	66336 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`1s9k__assembly_1__model_1`	pentameric （5）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Human IL-2 ARRE1 Promoter Element, Plus Strand
Molecular weight formula_weight	6211.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	A
Atom count atom_count	3887

TTTGAAAATATGTGTAATAG

Entity 2 Entity 2 polymer

Description description	Human IL-2 ARRE1 Promoter Element, Minus Strand
Molecular weight formula_weight	6051.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B

AACTATTACACATATTTTCA

Entity 3 Entity 3 polymer

Description description	Nuclear factor of activated T-cells, cytoplasmic 2
Molecular weight formula_weight	31874.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

WPLSSQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHIPESSGRIVSLQTASNPIECSQRSAHELPMVERQDTDSCLVYGGQQMILTGQNFTSESKVVFTEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRTPVKVNFYVINGKRKRSQPQHFTYHPV

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	Proto-oncogene protein c-fos
Molecular weight formula_weight	6370.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	D

RRIRRERNKMAAAKCRNRRRELTDTLQAETDQLEDEKSALQTEIANLLKEKEK

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 5 Entity 5 polymer

Description description	Transcription factor AP-1
Molecular weight formula_weight	6139.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	E

RKRMRNRIAASKCRKRKLERIARLEEKVKTLKAQNSELASTANMLREQVAQL

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

▼

6. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d1s9kc1
Class class	b — All beta proteins
Fold Fold fold	b.1 — Immunoglobulin-like beta-sandwich
Superfamily Superfamily superfamily	b.1.18 — E set domains
Family Family family	b.1.18.1 — NF-kappa-B/REL/DORSAL transcription factors, C-terminal domain

Domain ID domain_id	d1s9kc2
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.3 — Rel/Dorsal transcription factors, DNA-binding domain

Domain ID domain_id	d1s9kd1
Class class	h — Coiled coil proteins
Fold Fold fold	h.1 — Parallel coiled-coil
Superfamily Superfamily superfamily	h.1.3 — Leucine zipper domain
Family Family family	h.1.3.1 — Leucine zipper domain

Domain ID domain_id	d1s9ke1
Class class	h — Coiled coil proteins
Fold Fold fold	h.1 — Parallel coiled-coil
Superfamily Superfamily superfamily	h.1.3 — Leucine zipper domain
Family Family family	h.1.3.1 — Leucine zipper domain

CATH v4.4 (4 domains)

Domain ID domain_id	1s9kC01
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	340 — Rel homology domain (RHD), DNA-binding domain

Domain ID domain_id	1s9kC02
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	10 — Immunoglobulins

Domain ID domain_id	1s9kD00
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	5 — Single alpha-helices involved in coiled-coils or other helix-helix interfaces
Homologous superfamily homologous superfamily	170 —

Domain ID domain_id	1s9kE00
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	5 — Single alpha-helices involved in coiled-coils or other helix-helix interfaces
Homologous superfamily homologous superfamily	170 —

▶

Unit-cell length a length_a	64.769 Å
Unit-cell length b length_b	86.260 Å
Unit-cell length c length_c	84.044 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	111.24 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	2

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	3.100 Å
Low-resolution limit resolution_low	30.000 Å
R factor r_factor	0.2423
R_work r_work	0.2423
R_free r_free	0.2746

Crystal Structure of Human NFAT1 and Fos-Jun on the IL-2 ARRE1 Site

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear factor of activated T-cells, cytoplasmic 2

State in the Current Structure

Other States of the Same Protein in the Database

Proto-oncogene protein c-fos

State in the Current Structure

Other States of the Same Protein in the Database

Transcription factor AP-1

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1s9k__assembly_1__model_1

1s9k__assembly_1__model_1 | I(q)

1s9k__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

6. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

CATH v4.4 (4 domains)

7. Citations (1)

Crystal Structure of Human NFAT1 and Fos-Jun on the IL-2 ARRE1 Site

1. Protein Identity and Related Structures Protein Identity & Related Structures

Nuclear factor of activated T-cells, cytoplasmic 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Proto-oncogene protein c-fos

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Transcription factor AP-1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

1s9k__assembly_1__model_1

1s9k__assembly_1__model_1 | I(q)

1s9k__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Source Source

Entity 5 Entity 5 polymer

Polymer Polymer

Source Source

6. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

CATH v4.4 (4 domains)

7. Citations (1)