SAXSdb — 3c28

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Recombinase cre

Bacteriophage P1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 4	LoxP DNA, chain C × 2 LoxP DNA, chain D × 2 water × 8	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RECR_BPP1
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–322； UniProt 20–341 Author chain B； PDBConstruct 1–322； UniProt 20–341

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3c28
Deposition date deposition_date	2008-01-24
Structure title title	Crystal structure of the product synapse complex
Keywords keywords	Synaptic complex, DNA integration, DNA recombination, recombination-DNA COMPLEX; recombination/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3c28__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3c28__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3c28__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.99 Å
Rg (electron density)	36.96 Å
Total Rg	37.44 Å
Atom count	12556
Residues	1364
Excluded volume	213740 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3c28__assembly_1__model_1`	octameric （8）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	LoxP DNA, chain C
Molecular weight formula_weight	10470.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C
Atom count atom_count	6602

ATAACTTCGTATAATGTATGCTATACGAAGTTAT

Entity 2 Entity 2 polymer

Description description	LoxP DNA, chain D
Molecular weight formula_weight	10439.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

ATAACTTCGTATAGCATACATTATACGAAGTTAT

Entity 3 Entity 3 polymer

Description description	Recombinase cre
Molecular weight formula_weight	36405.7 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

SDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLED

Source Source

Source organism organism

Bacteriophage P1

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	324

▼

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

Domain ID domain_id	3c28A01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	3c28A02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

Domain ID domain_id	3c28B01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	130 — Tyrosine recombinase, N-terminal domain

Domain ID domain_id	3c28B02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	443 — hpI Integrase; Chain A
Homologous superfamily homologous superfamily	10 — Intergrase catalytic core

▶

Unit-cell length a length_a	108.254 Å
Unit-cell length b length_b	122.453 Å
Unit-cell length c length_c	178.991 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	C 2 2 21
Space-group number int_tables_number	20
Crystal system crystal_system	—

Resolution resolution	2.600 Å
Low-resolution limit resolution_low	40.100 Å
R factor r_factor	0.2280
R_work r_work	0.2250
R_free r_free	0.2920

Crystal structure of the product synapse complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Recombinase cre

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3c28__assembly_1__model_1

3c28__assembly_1__model_1 | I(q)

3c28__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)

Crystal structure of the product synapse complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Recombinase cre

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3c28__assembly_1__model_1

3c28__assembly_1__model_1 | I(q)

3c28__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 4 domains

CATH v4.4 (4 domains)

7. Citations (1)