SAXSdb — 3coq

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Regulatory protein GAL4

Saccharomyces cerevisiae

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 2 DNA 2	;DNA (5'-D(DAPDCPDCPDGPDGPDAPDGPDGPDAPDCPDAPDGPDTPDCPDCPDTPDCPDCPDGPDG)-3') ; × 1 ;DNA (5'-D(DTPDCPDCPDGPDGPDAPDGPDGPDAPDCPDTPDGPDTPDCPDCPDTPDCPDCPDGPDG)-3') ; × 1 (4S)-2-METHYL-2,4-PENTANEDIOL × 1 ZINC ION × 4 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	GAL4_YEAST
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–89； UniProt 8–96 Author chain B； PDBConstruct 1–89； UniProt 8–96

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3coq
Deposition date deposition_date	2008-03-29
Structure title title	Structural Basis for Dimerization in DNA Recognition by Gal4
Keywords keywords	;helix bundle, Protein-DNA complex, zinc binuclear cluster, Activator, Carbohydrate metabolism, DNA-binding, Galactose metabolism, Metal-binding, Nucleus, Phosphoprotein, Transcription, Transcription regulation, Transcription-DNA COMPLEX ;; Transcription/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3coq__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3coq__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3coq__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	25.83 Å
Rg (electron density)	26.04 Å
Total Rg	26.70 Å
Atom count	2280
Residues	218
Excluded volume	38565 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3coq__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	;DNA (5'-D(DAPDCPDCPDGPDGPDAPDGPDGPDAPDCPDAPDGPDTPDCPDCPDTPDCPDCPDGPDG)-3') ;
Molecular weight formula_weight	6145.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D
Atom count atom_count	2313

ACCGGAGGACAGTCCTCCGG

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(DTPDCPDCPDGPDGPDAPDGPDGPDAPDCPDTPDGPDTPDCPDCPDTPDCPDCPDGPDG)-3') ;
Molecular weight formula_weight	6126.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

TCCGGAGGACTGTCCTCCGG

Entity 3 Entity 3 polymer

Description description	Regulatory protein GAL4
Molecular weight formula_weight	10484.5 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B

EQACDICRLKKLKCSKEKPKCAKCLKNNWECRYSPKTKRSPLTRAHLTEVESRLERLEQLFLLIFPREDLDMILKMDSLQDIKALLTGL

Source Source

Source organism organism	Saccharomyces cerevisiae
Common name common_name	;Baker's yeast ;
NCBI taxonomy ID ncbi_taxonomy_id	4932
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 non-polymer

Description description	(4S)-2-METHYL-2,4-PENTANEDIOL
Molecular weight formula_weight	118.2 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	33

▼

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d3coqa1
Class class	g — Small proteins
Fold Fold fold	g.38 — Zn2/Cys6 DNA-binding domain
Superfamily Superfamily superfamily	g.38.1 — Zn2/Cys6 DNA-binding domain
Family Family family	g.38.1.1 — Zn2/Cys6 DNA-binding domain

Domain ID domain_id	d3coqa2
Class class	h — Coiled coil proteins
Fold Fold fold	h.1 — Parallel coiled-coil
Superfamily Superfamily superfamily	h.1.3 — Leucine zipper domain
Family Family family	h.1.3.1 — Leucine zipper domain

Domain ID domain_id	d3coqb1
Class class	g — Small proteins
Fold Fold fold	g.38 — Zn2/Cys6 DNA-binding domain
Superfamily Superfamily superfamily	g.38.1 — Zn2/Cys6 DNA-binding domain
Family Family family	g.38.1.1 — Zn2/Cys6 DNA-binding domain

Domain ID domain_id	d3coqb2
Class class	h — Coiled coil proteins
Fold Fold fold	h.1 — Parallel coiled-coil
Superfamily Superfamily superfamily	h.1.3 — Leucine zipper domain
Family Family family	h.1.3.1 — Leucine zipper domain

CATH v4.4 (2 domains)

Domain ID domain_id	3coqA00
Class class	4 — Few Secondary Structures
Architecture architecture	10 — Irregular
Topology topology	240 — CD2-Gal4
Homologous superfamily homologous superfamily	10 — Zn(2)-C6 fungal-type DNA-binding domain

Domain ID domain_id	3coqB00
Class class	4 — Few Secondary Structures
Architecture architecture	10 — Irregular
Topology topology	240 — CD2-Gal4
Homologous superfamily homologous superfamily	10 — Zn(2)-C6 fungal-type DNA-binding domain

▶

Unit-cell length a length_a	126.495 Å
Unit-cell length b length_b	40.829 Å
Unit-cell length c length_c	90.418 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	95.88 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	2.400 Å
Low-resolution limit resolution_low	28.940 Å
R factor r_factor	0.2130
R_work r_work	0.2070
R_free r_free	0.2690

Structural Basis for Dimerization in DNA Recognition by Gal4

1. Protein Identity and Related Structures Protein Identity & Related Structures

Regulatory protein GAL4

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3coq__assembly_1__model_1

3coq__assembly_1__model_1 | I(q)

3coq__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (4 domains)

CATH v4.4 (2 domains)

7. Citations (1)

Structural Basis for Dimerization in DNA Recognition by Gal4

1. Protein Identity and Related Structures Protein Identity & Related Structures

Regulatory protein GAL4

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3coq__assembly_1__model_1

3coq__assembly_1__model_1 | I(q)

3coq__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (4 domains)

CATH v4.4 (2 domains)

7. Citations (1)