7uik

Mediator-PIC Early (Tail A + Upstream DNA & Activator)

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Regulatory protein GAL4

Saccharomyces cerevisiae S288C

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 8 DNA 2	DNA (38-MER) × 1 DNA (37-MER) × 1 Mediator of RNA polymerase II transcription subunit 15 × 1 （P19659） Mediator of RNA polymerase II transcription subunit 2 × 1 （Q12124） Mediator of RNA polymerase II transcription subunit 3 × 1 （P40356） Mediator of RNA polymerase II transcription subunit 14 × 1 （P19263） Mediator of RNA polymerase II transcription subunit 5 × 1 （P53114） Mediator of RNA polymerase II transcription subunit 16 × 1 （P32259） ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	GAL4_YEAST
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain T； PDBConstruct 1–147； UniProt 1–147 Author chain U； PDBConstruct 1–147； UniProt 1–147

Mediator of RNA polymerase II transcription subunit 15

OrganismNot specified

UniProt P19659

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 8 DNA 2	DNA (38-MER) × 1 DNA (37-MER) × 1 Regulatory protein GAL4 × 2 （P04386） Mediator of RNA polymerase II transcription subunit 2 × 1 （Q12124） Mediator of RNA polymerase II transcription subunit 3 × 1 （P40356） Mediator of RNA polymerase II transcription subunit 14 × 1 （P19263） Mediator of RNA polymerase II transcription subunit 5 × 1 （P53114） Mediator of RNA polymerase II transcription subunit 16 × 1 （P32259） ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MED15_YEAST
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain o； PDBConstruct 1–1081； UniProt 1–1081

Mediator of RNA polymerase II transcription subunit 2

OrganismNot specified

UniProt Q12124

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 8 DNA 2	DNA (38-MER) × 1 DNA (37-MER) × 1 Regulatory protein GAL4 × 2 （P04386） Mediator of RNA polymerase II transcription subunit 15 × 1 （P19659） Mediator of RNA polymerase II transcription subunit 3 × 1 （P40356） Mediator of RNA polymerase II transcription subunit 14 × 1 （P19263） Mediator of RNA polymerase II transcription subunit 5 × 1 （P53114） Mediator of RNA polymerase II transcription subunit 16 × 1 （P32259） ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MED2_YEAST
Isoform	—
PDB entities	5
Chains and sequence ranges	Author chain b； PDBConstruct 1–431； UniProt 1–431

Mediator of RNA polymerase II transcription subunit 3

OrganismNot specified

UniProt P40356

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 8 DNA 2	DNA (38-MER) × 1 DNA (37-MER) × 1 Regulatory protein GAL4 × 2 （P04386） Mediator of RNA polymerase II transcription subunit 15 × 1 （P19659） Mediator of RNA polymerase II transcription subunit 2 × 1 （Q12124） Mediator of RNA polymerase II transcription subunit 14 × 1 （P19263） Mediator of RNA polymerase II transcription subunit 5 × 1 （P53114） Mediator of RNA polymerase II transcription subunit 16 × 1 （P32259） ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MED3_YEAST
Isoform	—
PDB entities	6
Chains and sequence ranges	Author chain c； PDBConstruct 1–397； UniProt 1–397

Mediator of RNA polymerase II transcription subunit 14

OrganismNot specified

UniProt P19263

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 8 DNA 2	DNA (38-MER) × 1 DNA (37-MER) × 1 Regulatory protein GAL4 × 2 （P04386） Mediator of RNA polymerase II transcription subunit 15 × 1 （P19659） Mediator of RNA polymerase II transcription subunit 2 × 1 （Q12124） Mediator of RNA polymerase II transcription subunit 3 × 1 （P40356） Mediator of RNA polymerase II transcription subunit 5 × 1 （P53114） Mediator of RNA polymerase II transcription subunit 16 × 1 （P32259） ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MED14_YEAST
Isoform	—
PDB entities	7
Chains and sequence ranges	Author chain n； PDBConstruct 1–241； UniProt 834–1074

Mediator of RNA polymerase II transcription subunit 5

OrganismNot specified

UniProt P53114

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 8 DNA 2	DNA (38-MER) × 1 DNA (37-MER) × 1 Regulatory protein GAL4 × 2 （P04386） Mediator of RNA polymerase II transcription subunit 15 × 1 （P19659） Mediator of RNA polymerase II transcription subunit 2 × 1 （Q12124） Mediator of RNA polymerase II transcription subunit 3 × 1 （P40356） Mediator of RNA polymerase II transcription subunit 14 × 1 （P19263） Mediator of RNA polymerase II transcription subunit 16 × 1 （P32259） ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MED5_YEAST
Isoform	—
PDB entities	8
Chains and sequence ranges	Author chain e； PDBConstruct 1–1132； UniProt 1–1132

Mediator of RNA polymerase II transcription subunit 16

OrganismNot specified

UniProt P32259

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 8 DNA 2	DNA (38-MER) × 1 DNA (37-MER) × 1 Regulatory protein GAL4 × 2 （P04386） Mediator of RNA polymerase II transcription subunit 15 × 1 （P19659） Mediator of RNA polymerase II transcription subunit 2 × 1 （Q12124） Mediator of RNA polymerase II transcription subunit 3 × 1 （P40356） Mediator of RNA polymerase II transcription subunit 14 × 1 （P19263） Mediator of RNA polymerase II transcription subunit 5 × 1 （P53114） ZINC ION × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MED16_YEAST
Isoform	—
PDB entities	9
Chains and sequence ranges	Author chain p； PDBConstruct 1–974； UniProt 1–974

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7uik
Deposition date deposition_date	2022-03-29
Structure title title	Mediator-PIC Early (Tail A + Upstream DNA & Activator)
Keywords keywords	;Divergent transcription, Mediator, RNA Polymerase II, PIC, Pre-Initiation, Activation, Transcription Factor, Gal4, Gal4VP16, TRANSCRIPTION ;; TRANSCRIPTION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7uik__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7uik__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7uik__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	57.95 Å
Rg (electron density)	57.09 Å
Total Rg	57.30 Å
Atom count	20237
Residues	2383
Excluded volume	358830 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7uik__assembly_1__model_1`	decameric （10）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (10)

Entity 1 Entity 1 polymer

Description description	DNA (38-MER)
Molecular weight formula_weight	11666.5 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	X
Atom count atom_count	20237

ACCGGAGGACAGTCCTCCCGACTGACTGACGTCGTACG

Source Source

Source organism organism	Saccharomyces cerevisiae
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA (37-MER)
Molecular weight formula_weight	11424.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	Y

CGTACGACGTCAGTCAGTCGGGAGGACTGTCCTCCGG

Source Source

Source organism organism	Saccharomyces cerevisiae
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	Regulatory protein GAL4
Molecular weight formula_weight	16895.7 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	T,U

MKLLSSIEQACDICRLKKLKCSKEKPKCAKCLKNNWECRYSPKTKRSPLTRAHLTEVESRLERLEQLFLLIFPREDLDMILKMDSLQDIKALLTGLFVQDNVNKDAVTDRLASVETDMPLTLRQHRISATSSSEESSNKGQRQLTVS

Source Source

Source organism organism	Saccharomyces cerevisiae S288C
NCBI taxonomy ID ncbi_taxonomy_id	559292
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	Mediator of RNA polymerase II transcription subunit 15
Molecular weight formula_weight	120432.2 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	o

MSAAPVQDKDTLSNAERAKNVNGLLQVLMDINTLNGGSSDTADKIRIHAKNFEAALFAKSSSKKEYMDSMNEKVAVMRNTYNTRKNAVTAAAANNNIKPVEQHHINNLKNSGNSANNMNVNMNLNPQMFLNQQAQARQQVAQQLRNQQQQQQQQQQQQRRQLTPQQQQLVNQMKVAPIPKQLLQRIPNIPPNINTWQQVTALAQQKLLTPQDMEAAKEVYKIHQQLLFKARLQQQQAQAQAQANNNNNGLPQNGNINNNINIPQQQQMQPPNSSANNNPLQQQSSQNTVPNVLNQINQIFSPEEQRSLLQEAIETCKNFEKTQLGSTMTEPVKQSFIRKYINQKALRKIQALRDVKNNNNANNNGSNLQRAQNVPMNIIQQQQQQNTNNNDTIATSATPNAAAFSQQQNASSKLYQMQQQQQAQAQAQAQAQAQAQAQAQAQAAQAAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAQAHAQHQPSQQPQQAQQQPNPLHGLTPTAKDVEVIKQLSLDASKTNLRLTDVTNSLSNEEKEKIKMKLKQGQKLFVQVSNFAPQVYIITKNENFLKEVFQLRIFVKEILEKCAEGIFVVKLDTVDRLIIKYQKYWESMRIQILRRQAILRQQQQMANNNGNPGTTSTGNNNNIATQQNMQQSLQQMQHLQQLKMQQQQQQQQQQQQQQQQQQQQQQQHIYPSSTPGVANYSAMANAPGNNIPYMNHKNTSSMDFLNSMENTPKVPVSAAATPSLNKTINGKVNGRTKSNTIPVTSIPSTNKKLSISNAASQQPTPRSASNTAKSTPNTNPSPLKTQTKNGTPNPNNMKTVQSPMGAQPSYNSAIIENAFRKEELLLKDLEIRKLEISSRFKHRQEIFKDSPMDLFMSTLGDCLGIKDEEMLTSCTIPKAVVDHINGSGKRKPTKAAQRARDQDSIDISIKDNKLVMKSKFNKSNRSYSIALSNVAAIFKGIGGNFKDLSTLVHSSSPSTSSNMDVGNPRKRKASVLEISPQDSIASVLSPDSNIMSDSKKIKVDSPDDPFMTKSGATTSEKQEVTNEAPFLTSGTSSEQFNVWDWNNWTSAT

Entity 5 Entity 5 polymer

Description description	Mediator of RNA polymerase II transcription subunit 2
Molecular weight formula_weight	47754.3 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	b

MVVQNSPVSSVHTANFSERGSNTRTMTYKNKLTVCFDDILKVGAEMMMQQQLKNVQLDSYLVNGFSQSQQKLLKEKVKLFHGILDDLETSLSQSSSYLETLTALGKEKEKEREEAEKKRAEQENMRKVREQEELKKRQELEEASQQQQLQQNSKEKNGLGLNFSTTAPANTTDANGSKENYQELGSLQSSSQTQLENANAANNGAAFSPLTTTRIQSQQAQPSDVMFNDLNSMDISMFSGLDSTGFDSTAFNATVDETKGFDDNDSGNNYNDINISSIENNINNNINSTKNGKDNNNESNKNNNGDEKNKNNNEDNENNNNSSEKNNNNNNNNNNNNDDNGNNNNNNSGNDNNNTTNNDSNNKNNSITTGNDNENIVNNDLPTTVVSNPGDNPPPADNGEEYLTLNDFNDLNIDWSTTGDNGELDLSGFNI

Entity 6 Entity 6 polymer

Description description	Mediator of RNA polymerase II transcription subunit 3
Molecular weight formula_weight	43116.0 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	c

MDSIIPAGVKLDDLQVILAKNENETRDKVCKQINEARDEILPLRLQFNEFIQIMANIDQEGSKQADRMAKYLHIRDKILQLNDRFQTLSSHLEALQPLFSTVPEYLKTADNRDRSFQLLEPLSTYNKNGNAVCSTATVVSTNHSAAASTPTTTATPHANPITHAHSLSNPNSTATMQHNPLAGKRGPKSGSTMGTPTVHNSTAAAPIAAPKKPRKPRQTKKAKAQAQAQAQAQAQVYAQQSTVQTPITASMAAALPNPTPSMINSVSPTNVMGTPLTNMMSPMGNAYSMGAQNQGGQVSMSQFNGSGNGSNPNTNTNSNNTPLQSQLNLNNLTPANILNMSMNNDFQQQQQQQQQQQQPQPQYNMNMGMNNMNNGGKELDSLDLNNLELGGLNMDFL

Entity 7 Entity 7 polymer

Description description	Mediator of RNA polymerase II transcription subunit 14
Molecular weight formula_weight	27535.5 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	n

MQLVVLTDVVERLHKNFESENFKIIALQPNEISFKYLSNNDEDDKDCTIKISTNDDSIKNLTVQLSPSNPQHIIQPFLDNSKMDYHFIFSYLQFTSSLFKALKVILNERGGKFHESGSQYSTMVNIGLHNLNEYQIVYYNPQAGTKITICIELKTVLHNGRDKIQFHIHFADVAHITTKSPAYPMMHQVRNQVFMLDTKRLGTPESVKPANASHAIRLGNGVACDPSEIEPILMEIHNILK

Entity 8 Entity 8 polymer

Description description	Mediator of RNA polymerase II transcription subunit 5
Molecular weight formula_weight	128918.8 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	e

MEKESVYNLALKCAERQLTSMEFSNLYKEFFNEKFPSLIQEEEEDTTTTANINEVKKASDLVDTPSNNTAATADTTHLHEALDIVCSDFVKILNLEKPLILADYIVEVLLVNYNSDMIKCFLPKLNSVRNSLLLAHFFSKSCSFFAKLSDTLIIDQVRKDLGNVIVPNILSLDMNSMNKELIAIVSKLLQTTLKLSPSPILLTSAGCKNGSFTLLNQLSQTNKLLFKRVSQTFEAKLHFKDTKPFLNKDSTNEFVGSPSLTSPQYIPSPLSSTKPPGSVNSAAKYKDMKLLRYYKNIWLNNKIINWEISNPDFLSKYSAITSSIFQESFNSVQNLDQLLTDLIETSFTCFAQFVSNKQYHQANSNLTLLERKWVIFITKHLPLLILENSSRSPRVVTNALDNIDEKVVKAIRIYFTEKDDNKTNNEDLFDDYPSTSLDIRHDFIKGLIMLNLQPASVINNYLREDQMIDTSILPTRDDLFVRNLQGIQEVVHNTNSFIISSLDTLELESITESITHDSSNGLFQVLHNFESVAPTKQREIVKAFLSIFEDAIKELNYNRIAKICALLFFNFSHSLTTILSFSSPAALMKTLIKFVDLSRNGRNGSNGNDESSEYETINISLSFSWAILLIINLTQTYGISVVDVALKYPELSIKNSFIINFISNLPNVSDKYYLEESNVNDSDMLTKSHNTVQSWLCDLFVNGSITDQLIQNIETRQLANLIPFIVKQVLLSVEIGVLTDISSLIGGFEYFLQPLLLVGLIKTFYWLEQFLSCVKNDTISEDILQGIFNLLNTLFNPVTLNEDSKAFHTAVLRLNAIPLLKVLRKFRVQSQSNYGIYSSDAQGDPNLEPLIAKLVAVLNVSPVYDVDPRIINSENDYSRKQLGYGKFLILNENPINKIMTNQINSFWSLHSSTYYNLDYLFELIELVTPKSFLFDVLKTLEYKLATYGVPGSENKRGSLDSEHVFDYFFYFLVLYDVKTAEEASQLIEYMENDAKKSKGDVDIKGEDLHEKNDSAEVRQETQPKAEATQDDDFDMLFGENDTSTQAYEEEEENEDNDGNNRTNNVPMIKAEETPSKTNKISILKRHSFAVLLHERKLLNDLALENGEITKTENEKFISYHDKYLCMLKTCVF

Entity 9 Entity 9 polymer

Description description	Mediator of RNA polymerase II transcription subunit 16
Molecular weight formula_weight	111423.4 kDa
Source method src_method	nat
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	p

MMLGEHLMSWSKTGIIAYSDSQSSNANICLTFLESINGINWRFHTPQKYVLHPQLHEVQYQESSSTLSTHSTTTSVNGSTTAGVGSTPNFGGNSNKSPPQFFYNISSIHWNNWFSLPGDMLAVCDELGNMTMLITGQRPDRATTYEKLTMVFQDNVYKIYNHVMPLKPVDKLKPMNIERKQTRKEYNTSILEFRWLTSSKSVIVSQFCAFDSSSNTYRSRAQQVPPYGVYHPPFIKYACLAIRKNGQIDFWYQFSNSKDHKKITLQLLDTSNQRFKDLQWLEFARITPMNDDQCMLITTYSKLSKNISFYKLHVNWNLNATKPNVLNDPSLKIQFILSTTLDPTDDEGHVLKLENLHVVSKSSIEKDPSPEILVLYNVCDTSKSLVKRYRLAPTQLSAEYLVILKPDLNIDRNNSTNQIFQSRRYNLRRHSDIVLDKKVTLITSEMFDAFVSFYFEDGTIESYNQNDWKLETERLISQSQLGKFKNIIASPLSAGFNYGKLPLPPSVEWMKVSPSMCGVIVKQYNKKWPQFYAAVQKNYADPEKDSINATALAFGYVKSLHKQISAEDLTIAAKTHILRISFLDRKRAKEFITTLLKSLYSFFNISPDAPKEIMDKIITSRPLQKIMLLQLELGSCFSQENIEEMARVILYLKNVLFAFNGVARNFHFAIEQISNNSNQQQNPKLFQTIFSKQDLIHSLIPVAKWFVKFITYLTQEILILINDPTNKEYTLVHGIFGAKMSRTLILSILNEIKKVTQIVAKFPETSYPILNESSTFLKLVLSESPVDFEKFETFLVDVNNKFIALCEQQPSQEREFSLLVKAEIPPEYAKVGDFLLQYANNAVISHANAAAVYFADTSGLKISNSEFFNPEIFHLLQPLEEGLIIDTDKLPIKNRTSKSFSKLLYDDVTCDKLSVSEISDGKLKRCSRCGSVTRAGNIISSDKTIVPTSIQTKRWPTMYTRLCICSGMLFEMDG

Entity 10 Entity 10 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	7.70 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	199834

Mediator-PIC Early (Tail A + Upstream DNA & Activator)

1. Protein Identity and Related Structures Protein Identity & Related Structures

Regulatory protein GAL4

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Mediator of RNA polymerase II transcription subunit 15

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Mediator of RNA polymerase II transcription subunit 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Mediator of RNA polymerase II transcription subunit 3

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Mediator of RNA polymerase II transcription subunit 14

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Mediator of RNA polymerase II transcription subunit 5

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

Mediator of RNA polymerase II transcription subunit 16

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7uik__assembly_1__model_1

7uik__assembly_1__model_1 | I(q)

7uik__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (10)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer