SAXSdb — 3e2e

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

Bacteriophage T7

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Other combination	Monomer	Protein 1 DNA 2 RNA 1	;RNA (5'-R(GPGPGPAPGPUP*G)-3') ; × 1 DNA (31-MER) × 1 DNA (28-MER) × 1 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPOL_BPT7
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 7–889； UniProt 1–883

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3e2e
Deposition date deposition_date	2008-08-05
Structure title title	Crystal Structure of an Intermediate Complex of T7 RNAP and 7nt of RNA
Keywords keywords	T7 RNA Polymerase, DNA-directed RNA Polymerase, Transcription, Nucleotidyltransferase, Transferase, Transferase-RNA-DNA COMPLEX; Transferase/RNA/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3e2e__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3e2e__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3e2e__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	31.30 Å
Rg (electron density)	30.48 Å
Total Rg	31.25 Å
Atom count	7940
Residues	898
Excluded volume	137300 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3e2e__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	DNA-directed RNA polymerase
Molecular weight formula_weight	99829.2 kDa
EC 编号 ec_number	2.7.7.6
Mutation mutation	P266L
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	8013

HHHHHHMNTINIAKNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFERQLKAGEVADNAAAKPLITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNVEEQLNKRVGHVYKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSETIELAPEYAEAIATRAGALAGISLMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKPEDIDMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVTDENTGEISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA

Source Source

Source organism organism	Bacteriophage T7
NCBI taxonomy ID ncbi_taxonomy_id	10760
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	;RNA (5'-R(GPGPGPAPGPUP*G)-3') ;
Molecular weight formula_weight	2316.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R

GGGAGUG

Entity 3 Entity 3 polymer

Description description	DNA (31-MER)
Molecular weight formula_weight	10121.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	T

AGCCGTGCGCACTCCCTATAGTGAGTCGTATTA

Entity 4 Entity 4 polymer

Description description	DNA (28-MER)
Molecular weight formula_weight	10080.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	N

TAATACGACTCACTATATTTCTGGCGCACGGCT

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	73

▼

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (1 domains)

Domain ID domain_id	d3e2ea_
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.8 — DNA/RNA polymerases
Superfamily Superfamily superfamily	e.8.1 — DNA/RNA polymerases
Family Family family	e.8.1.3 — T7 RNA polymerase

CATH v4.4 (5 domains)

Domain ID domain_id	3e2eA01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1320 — T7 RNA polymerase; domain 1
Homologous superfamily homologous superfamily	10 — DNA-directed RNA polymerase, N-terminal domain

Domain ID domain_id	3e2eA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	260 —

Domain ID domain_id	3e2eA03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	370 —

Domain ID domain_id	3e2eA04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	280 —

Domain ID domain_id	3e2eA05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	20 — 5' to 3' exonuclease, C-terminal subdomain

▶

Unit-cell length a length_a	81.008 Å
Unit-cell length b length_b	81.008 Å
Unit-cell length c length_c	358.791 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	6

Space group space_group	P 61
Space-group number int_tables_number	169
Crystal system crystal_system	—

Resolution resolution	3.000 Å
Low-resolution limit resolution_low	37.800 Å
R factor r_factor	0.2430
R_work r_work	0.2404
R_free r_free	0.2916

Crystal Structure of an Intermediate Complex of T7 RNAP and 7nt of RNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3e2e__assembly_1__model_1

3e2e__assembly_1__model_1 | I(q)

3e2e__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (1 domains)

CATH v4.4 (5 domains)

7. Citations (1)

Crystal Structure of an Intermediate Complex of T7 RNAP and 7nt of RNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3e2e__assembly_1__model_1

3e2e__assembly_1__model_1 | I(q)

3e2e__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (1 domains)

CATH v4.4 (5 domains)

7. Citations (1)