4gdf

A Crystal Structure of SV40 Large T Antigen

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Large T antigen

Simian virus 40

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 2 DNA 2	DNA (32-MER) × 1 DNA (32-MER) × 1 ZINC ION × 2 water × 4	Consistent with all polymers
2	Protein–DNA	Homooligomer	Protein 2 DNA 2	DNA (32-MER) × 1 DNA (32-MER) × 1 ZINC ION × 2 water × 4	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	Q9DH70_SV40
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–497； UniProt 131–627 Author chain B； PDBConstruct 1–497； UniProt 131–627 Author chain E； PDBConstruct 1–497； UniProt 131–627 Author chain F； PDBConstruct 1–497； UniProt 131–627

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4gdf
Deposition date deposition_date	2012-07-31
Structure title title	A Crystal Structure of SV40 Large T Antigen
Keywords keywords	SV40 Large T Antigen, DNA replication, helicase, primase, HYDROLASE-DNA complex; HYDROLASE/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4gdf__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4gdf__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4gdf__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	38.08 Å
Rg (electron density)	37.67 Å
Total Rg	37.97 Å
Atom count	9378
Residues	1058
Excluded volume	164420 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4gdf__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download
2	1	`4gdf__assembly_2__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Large T antigen
Molecular weight formula_weight	57450.4 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,E,F
Atom count atom_count	18835

KVEDPKDFPSELLSFLSHAVFSNRTLACFAIYTTKEKAALLYKKIMEKYSVTFISRHNSYNHNILFFLTPHRHRVSAINNYAQKLCTFSFLICKGVNKEYLMYSALTRDPFSVIEESLPGGLKEHDFNPEEAEETKQVSWKLVTEYAMETKCDDVLLLLGMYLEFQYSFEMCLKCIKKEQPSHYKYHEKHYANAAIFADSKNQKTICQQAVDTVLAKKRVDSLQLTREQMLTNRFNDLLDRMDIMFGSTGSADIEEWMAGVAWLHCLLPKMDSVVYDFLKCMVYNIPKKRYWLFKGPIDSGKTTLAAALLELCGGKALNVNLPLDRLNFELGVAIDQFLVVFEDVKGTGGESRDLPSGQGINNLDNLRDYLDGSVKVNLEKKHLNKRTQIFPPGIVTMNEYSVPKTLQARFVKQIDFRPKDYLKHCLERSEFLLEKRIIQSGIALLLMLIWYRPVAEFAQSIQSRIVEWKERLDKEFSLSVYQKMKFNVAMGIGVLD

Source Source

Source organism organism	Simian virus 40
Common name common_name	SV40
NCBI taxonomy ID ncbi_taxonomy_id	10633
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA (32-MER)
Molecular weight formula_weight	9891.4 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C,G

ACTACTTCTGGAATAGCTCAGAGGCCGAGGCG

Entity 3 Entity 3 polymer

Description description	DNA (32-MER)
Molecular weight formula_weight	9793.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D,H

CGCCTCGGCCTCTGAGCTATTCCAGAAGTAGT

Entity 4 Entity 4 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 5 Entity 5 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	79

▼

6. Fold Classification (SCOP + CATH) 16 domains

CATH v4.4 (16 domains)

Domain ID domain_id	4gdfA01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1310 — Replication Protein E1; Chain: A,
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4gdfA02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	510 — Zinc finger, large T-antigen D1 domain

Domain ID domain_id	4gdfA03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1050 — Glutathione S-transferase Yfyf (Class Pi); Chain A, domain 2
Homologous superfamily homologous superfamily	70 — Large T antigen, SV40, domain 3

Domain ID domain_id	4gdfA04
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4gdfB01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1310 — Replication Protein E1; Chain: A,
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4gdfB02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	510 — Zinc finger, large T-antigen D1 domain

Domain ID domain_id	4gdfB03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1050 — Glutathione S-transferase Yfyf (Class Pi); Chain A, domain 2
Homologous superfamily homologous superfamily	70 — Large T antigen, SV40, domain 3

Domain ID domain_id	4gdfB04
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4gdfE01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1310 — Replication Protein E1; Chain: A,
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4gdfE02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	510 — Zinc finger, large T-antigen D1 domain

Domain ID domain_id	4gdfE03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1050 — Glutathione S-transferase Yfyf (Class Pi); Chain A, domain 2
Homologous superfamily homologous superfamily	70 — Large T antigen, SV40, domain 3

Domain ID domain_id	4gdfE04
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

Domain ID domain_id	4gdfF01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	1310 — Replication Protein E1; Chain: A,
Homologous superfamily homologous superfamily	20 —

Domain ID domain_id	4gdfF02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	10 — Arc Repressor Mutant, subunit A
Homologous superfamily homologous superfamily	510 — Zinc finger, large T-antigen D1 domain

Domain ID domain_id	4gdfF03
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1050 — Glutathione S-transferase Yfyf (Class Pi); Chain A, domain 2
Homologous superfamily homologous superfamily	70 — Large T antigen, SV40, domain 3

Domain ID domain_id	4gdfF04
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	300 — P-loop containing nucleotide triphosphate hydrolases

▶

Unit-cell length a length_a	73.633 Å
Unit-cell length b length_b	128.307 Å
Unit-cell length c length_c	166.120 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	89.91 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.800 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	—
R_work r_work	0.2269
R_free r_free	0.2549

A Crystal Structure of SV40 Large T Antigen

1. Protein Identity and Related Structures Protein Identity & Related Structures

Large T antigen

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4gdf__assembly_1__model_1

4gdf__assembly_1__model_1 | I(q)

4gdf__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 16 domains

CATH v4.4 (16 domains)

7. Citations (1)

A Crystal Structure of SV40 Large T Antigen

1. Protein Identity and Related Structures Protein Identity & Related Structures

Large T antigen

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4gdf__assembly_1__model_1

4gdf__assembly_1__model_1 | I(q)

4gdf__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 water

6. Fold Classification (SCOP + CATH) 16 domains

CATH v4.4 (16 domains)

7. Citations (1)