SAXSdb — 4v2s

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-BINDING PROTEIN HFQ

ESCHERICHIA COLI

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–RNA	Homooligomer	Protein 6 RNA 1	RYDC × 1 water × 7	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	HFQ_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–102； UniProt 1–102 Author chain B； PDBConstruct 1–102； UniProt 1–102 Author chain C； PDBConstruct 1–102； UniProt 1–102 Author chain D； PDBConstruct 1–102； UniProt 1–102 Author chain E； PDBConstruct 1–102； UniProt 1–102 Author chain F； PDBConstruct 1–102； UniProt 1–102

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4v2s
Deposition date deposition_date	2014-10-14
Structure title title	Crystal structure of Hfq in complex with the sRNA RydC
Keywords keywords	RNA BINDING PROTEIN-RNA COMPLEX, NATIVELY UNSTRUCTURED PROTEIN, PROTEIN-RNA RECOGNITION; RNA BINDING PROTEIN/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

4v2s__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

4v2s__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

4v2s__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	29.20 Å
Rg (electron density)	27.57 Å
Total Rg	28.42 Å
Atom count	4425
Residues	475
Excluded volume	75270 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`4v2s__assembly_1__model_1`	heptameric （7）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	RNA-BINDING PROTEIN HFQ
Molecular weight formula_weight	11179.4 kDa
Source method src_method	man
Copy count entity_count	6

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F
Atom count atom_count	4470

MAKGQSLQDPFLNALRRERVPVSIYLVNGIKLQGQIESFDQFVILLKNTVSQMVYKHAISTVVPSRPVSHHSNNAGGGTSSNYHHGSSAQNTSAQQDSEETE

Source Source

Source organism organism	ESCHERICHIA COLI
NCBI taxonomy ID ncbi_taxonomy_id	83333
Host organism host_organism	ESCHERICHIA COLI

Entity 2 Entity 2 polymer

Description description	RYDC
Molecular weight formula_weight	20699.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	Q

UUCCGAUGUAGACCCGUCCUCCUUCGCCUGCGUCACGGGUCCUGGUUAGACGCAGGCGUUUUCUG

Entity 3 Entity 3 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	45

▼

6. Fold Classification (SCOP + CATH) 6 domains

CATH v4.4 (6 domains)

Domain ID domain_id	4v2sA00
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	100 —

Domain ID domain_id	4v2sB00
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	100 —

Domain ID domain_id	4v2sC00
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	100 —

Domain ID domain_id	4v2sD00
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	100 —

Domain ID domain_id	4v2sE00
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	100 —

Domain ID domain_id	4v2sF00
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	100 —

▶

Unit-cell length a length_a	71.940 Å
Unit-cell length b length_b	73.356 Å
Unit-cell length c length_c	137.947 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	24

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	3.480 Å
Low-resolution limit resolution_low	24.320 Å
R factor r_factor	0.2199
R_work r_work	0.2169
R_free r_free	0.2816

Crystal structure of Hfq in complex with the sRNA RydC

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-BINDING PROTEIN HFQ

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4v2s__assembly_1__model_1

4v2s__assembly_1__model_1 | I(q)

4v2s__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 6 domains

CATH v4.4 (6 domains)

7. Citations (1)

Crystal structure of Hfq in complex with the sRNA RydC

1. Protein Identity and Related Structures Protein Identity & Related Structures

RNA-BINDING PROTEIN HFQ

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

4v2s__assembly_1__model_1

4v2s__assembly_1__model_1 | I(q)

4v2s__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 water

6. Fold Classification (SCOP + CATH) 6 domains

CATH v4.4 (6 domains)

7. Citations (1)