6w3l

APE1 exonuclease substrate complex wild-type

Method: X-RAY DIFFRACTION Dmax: 103.5 Å Quality: GOOD

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-(apurinic or apyrimidinic site) lyase

Homo sapiens

UniProt P27695

State in the Current Structure

Assembly Oligomeric State Construct Mutations and Modifications Ligands, Ions and Associated Components Method and Experimental Conditions Structure Quality
1 Protein–DNA Monomer Protein × 1 DNA 3 PDB declaration: tetrameric(4) Consistent with all polymer counts Chain B; UniProt 43–318 Not recorded TCGACGGATCC × 1 GCTGATGCG(C7R) × 1 GGATCCGTCGATCGCATCAGC × 1 CA CALCIUM ION × 1 NA SODIUM ION × 1 X-RAY DIFFRACTION X-ray crystallization conditions:VAPOR DIFFUSION, SITTING DROP;291 K;7% PEG20000, 100 mM sodium citrate, 15% glycerol, 5 mM calcium chloride Resolution 2.59 Å R-free 0.277
2 Protein monomer Monomer Protein × 1 PDB declaration: monomeric(1) Consistent with protein copy count Chain A; UniProt 43–318 Not recorded NA SODIUM ION × 1 EDO 1,2-ETHANEDIOL × 1 X-RAY DIFFRACTION X-ray crystallization conditions:VAPOR DIFFUSION, SITTING DROP;291 K;7% PEG20000, 100 mM sodium citrate, 15% glycerol, 5 mM calcium chloride Resolution 2.59 Å R-free 0.277

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

66 other PDB entries and 122 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence
UniProt name APEX1_HUMAN
Isoform
PDB entities 4
Chains and sequence ranges Author chain A; PDBConstruct 1–276; UniProt 43–318 Author chain B; PDBConstruct 1–276; UniProt 43–318

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

SAXS profile for 6w3l

P(r) Distance Distribution P(r) Distribution

P(r) distribution for 6w3l
Download Download

2. Structure Basics 2. Structure Basics

Entry ID entry_id6w3l
Deposition date deposition_date2020-03-09
Structure title titleAPE1 exonuclease substrate complex wild-type
Keywords keywordsnuclease, abasic site, DNA repair, DNA BINDING PROTEIN, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method methodX-RAY DIFFRACTION

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier31.83
Radius of gyration Rg (electron density) rg_electron30.28
Forward intensity I(0) i0108721000.00
Molecular weight molecular_weight75022.0 kDa
Excluded volume excluded_volume90455 ų
Envelope volume envelope_volume115640 ų
Hydration-shell volume shell_volume32683 ų
Envelope diameter envelope_diameter110.3
Shell Rg shell_rg36.22
Envelope Rg envelope_rg30.73
Shape Rg shape_rg30.17
Total Rg total_rg31.06
Total atoms total_atoms5235
Residues n_residues593
Spherical-harmonic order n_harmonics20
q range q_range— – 0.5000 −1
Data points n_points101
Shell type shell_typedirectional
Solvent electron density solvent_density0.3340 e/ų
Shell contrast contrast_shell0.0300 e/ų
CRYSOL version crysol_version4.1.3

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax103.5
Rg (real space) rg_real31.97
Rg uncertainty (real space) rg_real_error0.80
I(0) (real space) i0_real1.0870e+08
I(0) uncertainty (real space) i0_real_error1.7370e+06
Rg (reciprocal space) rg_reciprocal31.92
I(0) (reciprocal space) i0_reciprocal108700000.0000
Solution quality estimate total_estimate0.8709
Solution quality rating solution_quality GOOD a GOOD solution
P(r) peaks n_peaks2
Primary peak position r_peak_primary29.0
Skewness Skewness skewness0.361
Kurtosis Kurtosis kurtosis-0.592
Angular range angular_range— – 0.2500 −1
Current regularization parameter α current_alpha0.0000
Highest regularization parameter α highest_alpha15060000.0000
Real-space data points n_real_points51
GNOM version gnom_version4.1.3
Quality Criteria quality_criteria AN1: 0.000; Oscil: 0.879; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.923; Smooth: 0.757

5. Crystallography and Experiment 5. Crystallography & Experiment

6. Entities and Polymers Entities & Polymers (8)

7. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

Domain ID domain_id6w3lA00
Class class3 — Alpha Beta
Architecture architecture60 — 4-Layer Sandwich
Topology topology10 — Deoxyribonuclease I; Chain A
Homologous superfamily homologous superfamily10 — Endonuclease/exonuclease/phosphatase
Domain ID domain_id6w3lB00
Class class3 — Alpha Beta
Architecture architecture60 — 4-Layer Sandwich
Topology topology10 — Deoxyribonuclease I; Chain A
Homologous superfamily homologous superfamily10 — Endonuclease/exonuclease/phosphatase

8. Citations (1)

9. Files and Curves (10)