SAXSdb — 7rhz

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Recombinase cre

Escherichia phage P1

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 2 DNA 2	DNA (44-MER) × 1 DNA (44-MER) × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RECR_BPP1
Isoform	—
PDB entities	1, 2
Chains and sequence ranges	Author chain A； PDBConstruct 1–343； UniProt 1–343 Author chain B； PDBConstruct 1–343； UniProt 1–343

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7rhz
Deposition date deposition_date	2021-07-19
Structure title title	Heterodimer of Cre recombinase mutants D33A/A36V/R192A and R72E/L115D/R119D in complex with loxP DNA.
Keywords keywords	Cre, recombinase, dimer, loxP, RECOMBINATION-DNA complex; RECOMBINATION/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7rhz__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7rhz__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7rhz__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	36.87 Å
Rg (electron density)	35.74 Å
Total Rg	36.19 Å
Atom count	12550
Residues	703
Excluded volume	112300 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7rhz__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Recombinase cre
Molecular weight formula_weight	38493.1 kDa
Mutation mutation	D33A, A36V, R192A
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	12550

MSNLLTVHQNLPALPVDATSDEVRKNLMDMFRARQVFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGAMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLEDGD

Source Source

Source organism organism	Escherichia phage P1
Common name common_name	Bacteriophage P1
NCBI taxonomy ID ncbi_taxonomy_id	10678
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Recombinase cre
Molecular weight formula_weight	38526.9 kDa
Mutation mutation	R72E, L115D, R119D
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MSNLLTVHQNLPALPVDATSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVEDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSDVMRDIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLEDGD

Source Source

Source organism organism	Escherichia phage P1
Common name common_name	Bacteriophage P1
NCBI taxonomy ID ncbi_taxonomy_id	10678
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	DNA (44-MER)
Molecular weight formula_weight	13491.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

GCCGCATAACTTCGTATAGCATACATTATACGAAGTTATCGCCG

Entity 4 Entity 4 polymer

Description description	DNA (44-MER)
Molecular weight formula_weight	13602.7 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CGGCGATAACTTCGTATAATGTATGCTATACGAAGTTATGCGGC

▶

Resolution resolution	4.48 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	256734

Heterodimer of Cre recombinase mutants D33A/A36V/R192A and R72E/L115D/R119D in complex with loxP DNA.

1. Protein Identity and Related Structures Protein Identity & Related Structures

Recombinase cre

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7rhz__assembly_1__model_1

7rhz__assembly_1__model_1 | I(q)

7rhz__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

7. Citations (1)

Heterodimer of Cre recombinase mutants D33A/A36V/R192A and R72E/L115D/R119D in complex with loxP DNA.

1. Protein Identity and Related Structures Protein Identity & Related Structures

Recombinase cre

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7rhz__assembly_1__model_1

7rhz__assembly_1__model_1 | I(q)

7rhz__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

7. Citations (1)