7rpw

Archaeal DNA ligase and heterotrimeric PCNA in complex with adenylated DNA

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase sliding clamp 1

Saccharolobus solfataricus

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 3	DNA polymerase sliding clamp 2 × 1 （Q97Z84） DNA polymerase sliding clamp 3 × 1 （P57765） Upstream strand DNA × 1 Downstream strand DNA × 1 Template strand DNA × 1 DNA ligase × 1 （Q980T8） MANGANESE (II) ION × 4 ADENOSINE MONOPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PCNA1_SACS2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 3–250； UniProt 2–249

DNA polymerase sliding clamp 2

Saccharolobus solfataricus

UniProt Q97Z84

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 3	DNA polymerase sliding clamp 1 × 1 （P57766） DNA polymerase sliding clamp 3 × 1 （P57765） Upstream strand DNA × 1 Downstream strand DNA × 1 Template strand DNA × 1 DNA ligase × 1 （Q980T8） MANGANESE (II) ION × 4 ADENOSINE MONOPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PCNA2_SACS2
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–245； UniProt 1–245

DNA polymerase sliding clamp 3

Saccharolobus solfataricus

UniProt P57765

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 3	DNA polymerase sliding clamp 1 × 1 （P57766） DNA polymerase sliding clamp 2 × 1 （Q97Z84） Upstream strand DNA × 1 Downstream strand DNA × 1 Template strand DNA × 1 DNA ligase × 1 （Q980T8） MANGANESE (II) ION × 4 ADENOSINE MONOPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PCNA3_SACS2
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 1–244； UniProt 1–244

DNA ligase

Saccharolobus solfataricus

UniProt Q980T8

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 4 DNA 3	DNA polymerase sliding clamp 1 × 1 （P57766） DNA polymerase sliding clamp 2 × 1 （Q97Z84） DNA polymerase sliding clamp 3 × 1 （P57765） Upstream strand DNA × 1 Downstream strand DNA × 1 Template strand DNA × 1 MANGANESE (II) ION × 4 ADENOSINE MONOPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	DNLI_SACS2
Isoform	—
PDB entities	7
Chains and sequence ranges	Author chain E； PDBConstruct 21–621； UniProt 1–601

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7rpw
Deposition date deposition_date	2021-08-04
Structure title title	Archaeal DNA ligase and heterotrimeric PCNA in complex with adenylated DNA
Keywords keywords	DNA ligase, PCNA, cryo-EM, LIGASE-DNA complex; LIGASE/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

7rpw__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

7rpw__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

7rpw__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	37.03 Å
Rg (electron density)	36.54 Å
Total Rg	37.01 Å
Atom count	10594
Residues	1241
Excluded volume	186490 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`7rpw__assembly_1__model_1`	heptameric （7）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Description description	DNA polymerase sliding clamp 1
Molecular weight formula_weight	28712.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	10594

MAFKIVYPNAKDFFSFINSITNVTDSIILNFTEDGIFSRHLTEDKVLMAIMRIPKDVLSEYSIDSPTSVKLDVSSVKKILSKASSKKATIELTETDSGLKIIIRDEKSGAKSTIYIKAEKGQVEQLTEPKVNLAVNFTTDESVLNVIAADVTLVGEEMRISTEEDKIKIEAGEEGKRYVAFLMKDKPLKELSIDTSASSSYSAEMFKDAVKGLRGFSAPTMVSFGENLPMKIDVEAVSGGHMIFWIAPRLLEHHHHHH

Source Source

Source organism organism	Saccharolobus solfataricus
Common name common_name	Sulfolobus solfataricus
NCBI taxonomy ID ncbi_taxonomy_id	2287
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA polymerase sliding clamp 2
Molecular weight formula_weight	27461.1 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MKAKVIDAVSFSYILRTVGDFLSEANFIVTKEGIRVSGIDPSRVVFLDIFLPSSYFEGFEVSQEKEIIGFKLEDVNDILKRVLKDDTLILSSNESKLTLTFDGEFTRSFELPLIQVESTQPPSVNLEFPFKAQLLTITFADIIDELSDLGEVLNIHSKENKLYFEVIGDLSTAKVELSTDNGTLLEASGADVSSSYGMEYVANTTKMRRASDSMELYFGSQIPLKLRFKLPQEGYGDFYIAPRAD

Source Source

Source organism organism	Saccharolobus solfataricus
Common name common_name	Sulfolobus solfataricus
NCBI taxonomy ID ncbi_taxonomy_id	2287
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	DNA polymerase sliding clamp 3
Molecular weight formula_weight	28560.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MKVVYDDVRVLKDIIQALARLVDEAVLKFKQDSVELVALDRAHISLISVNLPREMFKEYDVNDEFKFGFNTQYLMKILKVAKRKEAIEIASESPDSVIINIIGSTNREFNVRNLEVSEQEIPEINLQFDISATISSDGFKSAISEVSTVTDNVVVEGHEDRILIKAEGESEVEVEFSKDTGGLQDLEFSKESKNSYSAEYLDDVLSLTKLSDYVKISFGNQKPLQLFFNMEGGGKVTYLLAPKVLEHHHHHH

Source Source

Source organism organism	Saccharolobus solfataricus
Common name common_name	Sulfolobus solfataricus
NCBI taxonomy ID ncbi_taxonomy_id	2287
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 polymer

Description description	Upstream strand DNA
Molecular weight formula_weight	7376.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	X

GTATCCTCGTAGTGCAGATGCGTC

Entity 5 Entity 5 polymer

Description description	Downstream strand DNA
Molecular weight formula_weight	7127.6 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	Y

GTCGGACTGATTCGGTAGATCTG

Entity 6 Entity 6 polymer

Description description	Template strand DNA
Molecular weight formula_weight	14403.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	Z

CAGATCTACCGAATCAGTCCGACGACGCATCTGCACTACGAGGATAC

Entity 7 Entity 7 polymer

Description description	DNA ligase
Molecular weight formula_weight	69998.4 kDa
EC 编号 ec_number	6.5.1.1
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	E

MGSSHHHHHHSSGLVPRGSHMEFKVIAEYFDKLEKISSRLQLTALLADLLSKSDKTIIDKVVYIIQGKLWPDFLGYPELGIGEKFLIKAISIATNTDENSVENLYKTIGDLGEVARRLKSKQQSTGILGFLGTTSKESLTVDEVYSTLSKVALTTGEGSRDLKIRLLAGLLKKADPLEAKFLVRFVEGRLRVGIGDATVLDAMAIAFGGGQSASEIIERAYNLRADLGNIAKIIVEKGIEALKTLKPQVGIPIRPMLAERLSNPEEILKKMGGNAIVDYKYDGERAQIHKKEDKIFIFSRRLENITSQYPDVVDYVSKYIEGKEFIIEGEIVAIDPESGEMRPFQELMHRKRKSDIYEAIKEYPVNVFLFDLMYYEDVDYTTKPLEARRKLLESIVKPNDYVKIAHHIQANNVEDLKSFFYRAISEGGEGVMVKAIGKDAIYQAGARGWLWIKLKRDYQSEMADTVDLVVVGGFYGKGKRGGKISSLLMAAYNPKTDSFESVCKVASGFSDEQLDELQKKLMEIKRDVKHPRVNSKMEPDIWVEPVYVAEIIGSEITISPLHTCCQDVVEKDAGLSIRFPRFIRWRDDKSPEDATTTDEILEMYNKQPKKKIESPAVDESV

Source Source

Source organism organism	Saccharolobus solfataricus
Common name common_name	Sulfolobus solfataricus
NCBI taxonomy ID ncbi_taxonomy_id	2287
Host organism host_organism	Escherichia coli

Entity 8 Entity 8 non-polymer

Description description	MANGANESE (II) ION
Molecular weight formula_weight	54.9 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 9 Entity 9 non-polymer

Description description	ADENOSINE MONOPHOSPHATE
Molecular weight formula_weight	347.2 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	triclinic

Resolution resolution	4.38 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	152769

Archaeal DNA ligase and heterotrimeric PCNA in complex with adenylated DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase sliding clamp 1

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA polymerase sliding clamp 2

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA polymerase sliding clamp 3

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA ligase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

7rpw__assembly_1__model_1

7rpw__assembly_1__model_1 | I(q)

7rpw__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (9)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 polymer

Polymer Polymer

Entity 7 Entity 7 polymer

Polymer Polymer

Source Source

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

7. Citations (1)