SAXSdb — 8ooy

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase I

;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 3 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 328–928	Not recorded	Template DNA × 1 Extending Primer × 1 Displacing Primer × 1 MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer：pH 8.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 4.00 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 8OOY	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1D8Y CRYSTAL STRUCTURE OF THE COMPLEX OF DNA POLYMERASE I KLENOW FRAGMENT WITH DNA Deposited 1999-10-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 324–928（605 aa） Fragment：KLENOW FRAGMENT	Mutation：D355A, E357A	ZN ZINC ION × 1 SO4 SULFATE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.4；295 K；SODIUM CITRATE, pH 6.4, VAPOR DIFFUSION, SITTING DROP, temperature 295K	Resolution 2.08 Å R-free 0.233
1DPI STRUCTURE OF LARGE FRAGMENT OF ESCHERICHIA COLI DNA POLYMERASE I COMPLEXED WITH D/TMP Deposited 1987-08-11	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 324–928（605 aa）	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.80 Å
1KFD CRYSTAL STRUCTURES OF THE KLENOW FRAGMENT OF DNA POLYMERASE I COMPLEXED WITH DEOXYNUCLEOSIDE TRIPHOSPHATE AND PYROPHOSPHATE Deposited 1993-09-23	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 324–928（605 aa）	Not recorded	CTP CYTIDINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 3.90 Å
1KFS DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7) MUTANT/DNA COMPLEX Deposited 1997-08-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 324–928（605 aa）	Mutation：V324M	MG MAGNESIUM ION × 1 ZN ZINC ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.8；1.4 M NA CITRATE PH 5.8	Resolution 2.10 Å R-free 0.219
1KLN DNA POLYMERASE I KLENOW FRAGMENT (E.C.2.7.7.7) MUTANT/DNA COMPLEX Deposited 1994-05-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 324–928（605 aa）	Mutation：D355A	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 6.8；290 K；pH 6.80, VAPOR DIFFUSION, temperature 290.00K	Resolution 3.20 Å
1KRP DNA polymerase I Klenow fragment (E.C.2.7.7.7) mutant/DNA complex Deposited 1997-08-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 324–928（605 aa）	Mutation：V324M	ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.8；1.4 M NA CITRATE PH 5.8	Resolution 2.20 Å R-free 0.255
1KSP DNA polymerase I Klenow fragment (E.C.2.7.7.7) mutant/DNA complex Deposited 1997-08-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 324–928（605 aa）	Mutation：V324M	ZN ZINC ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.8；1.4 M NA CITRATE PH 5.8	Resolution 2.30 Å R-free 0.241
1QSL KLENOW FRAGMENT COMPLEXED WITH SINGLE-STRANDED SUBSTRATE AND EUROPIUM (III) ION Deposited 1999-06-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 324–928（605 aa） Fragment：KLENOW FRAGMENT	Mutation：V324M	EU EUROPIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.6；290 K；1.5 M SODIUM CITRATE AT 290 K, pH 5.60, VAPOR DIFFUSION, HANGING DROP	Resolution 2.20 Å R-free 0.255
2KFN KLENOW FRAGMENT WITH BRIDGING-SULFUR SUBSTRATE AND MANGANESE Deposited 1998-07-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 325–928（604 aa） Fragment：LARGE FRAGMENT, KLENOW FRAGMENT	Mutation：V324M	MN MANGANESE (II) ION × 1 ZN ZINC ION × 3 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.8；1.4 M NA CITRATE PH 5.8	Resolution 2.03 Å R-free 0.250
2KFZ KLENOW FRAGMENT WITH BRIDGING-SULFUR SUBSTRATE AND ZINC ONLY Deposited 1998-07-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 325–928（604 aa） Fragment：LARGE FRAGMENT, KLENOW FRAGMENT	Mutation：V324M	ZN ZINC ION × 4 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.8；1.4 M NA CITRATE PH 5.8	Resolution 2.03 Å R-free 0.255
2KZM KLENOW FRAGMENT WITH NORMAL SUBSTRATE AND ZINC AND MANGANESE Deposited 1998-07-03	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 324–928（605 aa） Fragment：KLENOW FRAGMENT, LARGE FRAGMENT	Not recorded	MN MANGANESE (II) ION × 1 ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.5；1.4 M SODIUM CITRATE PH 5.8, pH 5.5, VAPOR DIFFUSION, HANGING DROP	Resolution 2.60 Å R-free 0.243
2KZZ KLENOW FRAGMENT WITH NORMAL SUBSTRATE AND ZINC ONLY Deposited 1998-07-07	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 324–928（605 aa） Fragment：KLENOW FRAGMENT, LARGE FRAGMENT	Not recorded	ZN ZINC ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5.5；1.4 M SODIUM CITRATE PH 5.8, pH 5.5, VAPOR DIFFUSION, HANGING DROP	Resolution 2.25 Å R-free 0.251
8OO6 Pol I bound to extended and displaced DNA section - closed conformation Deposited 2023-04-04	Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 328–928（601 aa）	Not recorded	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.30 Å

13 other PDB entries and 13 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	DPO1_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 4–604； UniProt 328–928

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	8ooy
Deposition date deposition_date	2023-04-06
Structure title title	Pol I bound to extended and displaced DNA section - open conformation
Keywords keywords	DNA Polymerase I, Okazaki fragment maturation, DNA BINDING PROTEIN; DNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	29.55 Å
Radius of gyration Rg (electron density) rg_electron	28.63 Å
Forward intensity I(0) i0	141457000.00
Molecular weight molecular_weight	83663.0 kDa
Excluded volume excluded_volume	100270 Å³
Envelope volume envelope_volume	132680 Å³
Hydration-shell volume shell_volume	38363 Å³
Envelope diameter envelope_diameter	96.8 Å
Shell Rg shell_rg	36.21 Å
Envelope Rg envelope_rg	28.42 Å
Shape Rg shape_rg	28.61 Å
Total Rg total_rg	29.32 Å
Total atoms total_atoms	5828
Residues n_residues	655
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	90.8 Å
Rg (real space) rg_real	29.42 Å
Rg uncertainty (real space) rg_real_error	0.65 Å
I(0) (real space) i0_real	1.4150e+08
I(0) uncertainty (real space) i0_real_error	2.0370e+06
Rg (reciprocal space) rg_reciprocal	29.48 Å
I(0) (reciprocal space) i0_reciprocal	141500000.0000
Solution quality estimate total_estimate	0.9025
Solution quality rating solution_quality	EXCELLENT a EXCELLENT solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	38.7 Å
Skewness Skewness skewness	0.176
Kurtosis Kurtosis kurtosis	-0.420
Angular range angular_range	— – 0.2700 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	12870000.0000
Real-space data points n_real_points	55
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.941; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.988; Smooth: 0.919

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	DNA polymerase I
Molecular weight formula_weight	67991.5 kDa
EC 编号 ec_number	2.7.7.7
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	5828

GPHDNYVTILDEETLKAWIAKLEKAPVFAFDTETDSLDNISANLVGLSFAIEPGVAAYIPVAHDYLDAPDQISRERALELLKPLLEDEKALKVGQNLKYDRGILANYGIELRGIAFDTMLESYILNSVAGRHDMDSLAERWLKHKTITFEEIAGKGKNQLTFNQIALEEAGRYAAEDADVTLQLHLKMWPDLQKHKGPLNVFENIEMPLVPVLSRIERNGVKIDPKVLHNHSEELTLRLAELEKKAHEIAGEEFNLSSTKQLQTILFEKQGIKPLKKTPGGAPSTSEEVLEELALDYPLPKVILEYRGLAKLKSTYTDKLPLMINPKTGRVHTSYHQAVTATGRLSSTDPNLQNIPVRNEEGRRIRQAFIAPEDYVIVSADYSQIELRIMAHLSRDKGLLTAFAEGKDIHRATAAEVFGLPLETVTSEQRRSAKAINFGLIYGMSAFGLARQLNIPRKEAQKYMDLYFERYPGVLEYMERTRAQAKEQGYVETLDGRRLYLPDIKSSNGARRAAAERAAINAPMQGTAADIIKRAMIAVDAWLQAEQPRVRMIMQVHDELVFEVHKDDVDAVAKQIHQLMENCTRLDVPLLVEVGSGENWDQAH

来源 Source

来源生物 organism	;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;
NCBI Class编号 ncbi_taxonomy_id	866768
宿主生物 host_organism	;Escherichia coli 'BL21-Gold(DE3)pLysS AG' ;

Entity 2 Entity 2 polymer

Description description	Template DNA
Molecular weight formula_weight	8374.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide/polyribonucleotide hybrid
Chain IDs strand_id	T

AACGTCGTGACTGGGAAAACCCTGGC

Entity 3 Entity 3 polymer

Description description	Extending Primer
Molecular weight formula_weight	5691.5 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide/polyribonucleotide hybrid
Chain IDs strand_id	P

GCCAGGGTTTTCCCAGTC

Entity 4 Entity 4 polymer

Description description	Displacing Primer
Molecular weight formula_weight	2113.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CGACGTT

Entity 5 Entity 5 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

▼

7. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

Domain ID domain_id	8ooyA01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	8ooyA02
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	1060 — Taq DNA Polymerase; Chain T, domain 4
Homologous superfamily homologous superfamily	10 — Taq DNA Polymerase; Chain T, domain 4

Domain ID domain_id	8ooyA03
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	20 — 5' to 3' exonuclease, C-terminal subdomain

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	4.00 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	164102

fit	/app/data/saxs_computation/oo/8ooy/8ooy.fit
pddf	/app/data/pr_computation/oo/8ooy/8ooy.pr.out
profile	/app/data/saxs_computation/oo/8ooy/8ooy.dat

Pol I bound to extended and displaced DNA section - open conformation

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA polymerase I

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

7. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)