SAXSdb — 9nnp

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA replication helicase

Human alphaherpesvirus 1 strain 17

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 1	DNA primase × 1 （P10236） DNA helicase/primase complex-associated protein × 1 （P10192） ;DNA (5'-D(PTPAPCPAPTPAP*A)-3') ; × 1 ZINC ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	HELI_HHV11
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–852； UniProt 31–882

DNA primase

Human alphaherpesvirus 1 strain 17

UniProt P10236

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 1	DNA replication helicase × 1 （P10189） DNA helicase/primase complex-associated protein × 1 （P10192） ;DNA (5'-D(PTPAPCPAPTPAP*A)-3') ; × 1 ZINC ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	PRIM_HHV11
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain B； PDBConstruct 1–1058； UniProt 1–1058

DNA helicase/primase complex-associated protein

Human alphaherpesvirus 1 strain 17

UniProt P10192

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Heteromer	Protein 3 DNA 1	DNA replication helicase × 1 （P10189） DNA primase × 1 （P10236） ;DNA (5'-D(PTPAPCPAPTPAP*A)-3') ; × 1 ZINC ION × 2	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	HEPA_HHV11
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain C； PDBConstruct 1–750； UniProt 1–750

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9nnp
Deposition date deposition_date	2025-03-05
Last revision last_revision	2025-11-19
Structure title title	Composite structure of HSV-1 helicase-primase in complex with a forked DNA
Keywords keywords	DNA replication, HSV-1 helicase-primase, VIRAL PROTEIN, Transferase-Hydrolase-DNA complex; Transferase/Hydrolase/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9nnp__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9nnp__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9nnp__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	56.63 Å
Rg (electron density)	57.20 Å
Total Rg	57.02 Å
Atom count	19498
Residues	2517
Excluded volume	346190 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9nnp__assembly_1__model_1`	tetrameric （4）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	DNA replication helicase
Molecular weight formula_weight	95760.8 kDa
EC 编号 ec_number	3.6.4.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	19498

GRAEAFLNFTSMHGVQPILKRIRELSQQQLDGAQVPHLQWFRDVAALESPAGLPLREFPFAVYLITGNAGSGKSTCVQTINEVLDCVVTGATRIAAQNMYAKLSGAFLSRPINTIFHEFGFRGNHVQAQLGQYPYTLTSNPASLEDLQRRDLTYYWEVILDLTKRALAASGGEELRNEFRALAALERTLGLAEGALTRLAPATHGALPAFTRSNVIVIDEAGLLGRHLLTAVVYCWWMINALYHTPQYAARLRPVLVCVGSPTQTASLESTFEHQKLRCSVRQSENVLTYLICNRTLREYARLSYSWAIFINNKRCVEHEFGNLMKVLEYGLPITEEHMQFVDRFVVPENYITNPANLPGWTRLFSSHKEVSAYMAKLHAYLKVTREGEFVVFTLPVLTFVSVKEFDEYRRLTHQPGLTIEKWLTANASRITNYSQSQDQDAGHMRCEVHSKQQLVVARNDVTYVLNSQIAVTARLRKLVFGFSGTFRAFEAVLRDDSFVKTQGETSVEFAYRFLSRLIFSGLISFYNFLQRPGLDATQRTLAYARMGELTAEILSLRPKSSGVPTQASVMADAGAPGERAFDFKQLGPRDGGPDDFPDDDLDVIFAGLDEQQLDVFYCHYTPGEPETTAAVHTQFALLKRAFLGRFRILQELFGEAFEVAPFSTYVDNVIFRGCEMLTGSPRGGLMSVALQTDNYTLMGYTYARVFAFADELRRRHATANVAELLEEAPLPYVVLRDQHGFMSVVNTNISEFVESIDSTELAMAINADYGISSKLAMTITRSQGLSLDKVAICFTPGNLRLNSAYVAMSRTTSSEFLRMNLNPLRERHERDDVISEHILSALRDPNVVIVY

Source Source

Source organism organism	Human alphaherpesvirus 1 strain 17
NCBI taxonomy ID ncbi_taxonomy_id	10299
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 2 Entity 2 polymer

Description description	DNA primase
Molecular weight formula_weight	114558.6 kDa
EC 编号 ec_number	2.7.7.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MGQEDGNRGERRAAGTPVEVTALYATDGCVITSSIALLTNSLLGAEPVYIFSYDAYTHDGRADGPTEQDRFEESRALYQASGGLNGDSFRVTFCLLGTEVGGTHQARGRTRPMFVCRFERADDVAALQDALAHGTPLQPDHIAATLDAEATFALHANMILALTVAINNASPRTGRDAAAAQYDQGASLRSLVGRTSLGQRGLTTLYVHHEVRVLAAYRRAYYGSAQSPFWFLSKFGPDEKSLVLTTRYYLLQAQRLGGAGATYDLQAIKDICATYAIPHAPRPDTVSAASLTSFAAITRFCCTSQYARGAAAAGFPLYVERRIAADVRETSALEKFITHDRSCLRVSDREFITYIYLAHFECFSPPRLATHLRAVTTHDPNPAASTEQPSPLGREAVEQFFCHVRAQLNIGEYVKHNVTPRETVLDGDTAKAYLRARTYAPGALTPAPAYCGAVDSATKMMGRLADAEKLLVPRGWPAFAPASPGEDTAGGTPPPQTCGIVKRLLRLAATEQQGPTPPAIAALIRNAAVQTPLPVYRISMVPTGQAFAALAWDDWARITRDARLAEAVVSAEAAAHPDHGALGRRLTDRIRAQGPVMPPGGLDAGGQMYVNRNEIFNGALAITNIILDLDIALKEPVPFRRLHEALGHFRRGALAAVQLLFPAARVDPDAYPCYFFKSACRPGPASVGSGSGLGNDDDGDWFPCYDDAGDEEWAEDPGAMDTSHDPPDDEVAYFDLCHEVGPTAEPRETDSPVCSCTDKIGLRVCMPVPAPYVVHGSLTMRGVARVIQQAVLLDRDFVEAIGSYVKNFLLIDTGVYAHGHSLRLPYFAKIAPDGPACGRLLPVFVIPPACKDVPAFVAAHADPRRFHFHAPPTYLASPREIRVLHSLGGDYVSFFERKASRNALEHFGRRETLTEVLGRYNVQPDAGGTVEGFASELLGRIVACIETHFPEHAGEYQAVSVRRAVSKDDWVLLQLVPVRGTLQQSLSCLRFKHGRASRATARTFVALSVGANNRLCVSLCQQCFAAKCDSNRLHTLFTIDAGTPCSPSVPCSTSQPSS

Source Source

Source organism organism	Human alphaherpesvirus 1 strain 17
NCBI taxonomy ID ncbi_taxonomy_id	10299
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 3 Entity 3 polymer

Description description	DNA helicase/primase complex-associated protein
Molecular weight formula_weight	80005.7 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MDTADIVWVEESVSAITLYAVWLPPRAREYFHALVYFVCRNAAGEGRARFAEVSVTATELRDFYGSADVSVQAVVAAARAATTPAASPLEPLENPTLWRALYACVLAALERQTGPVALFAPLRIGSDPRTGLVVKVERASWGPPAAPRAALLVAEANIDIDPMALAARVAEHPDARLAWARLAAIRDTPQCASAASLTVNITTGTALFAREYQTLAFPPIKKEGAFGDLVEVCEVGLRPRGHPQRVTARVLLPRDYDYFVSAGEKFSAPALVALFRQWHTTVHAAPGALAPVFAFLGPEFEVRGGPVPYFAVLGFPGWPTFTVPATAESARDLVRGAAAAYAALLGAWPAVGARVVLPPRAWPGVASAAAGCLLPAVREAVARWHPATKIIQLLDPPAAVGPVWTARFCFPGLRAQLLAALADLGGSGLADPHGRTGLARLDALVVAAPSEPWAGAVLERLVPDTCNACPALRQLLGGVMAAVCLQIEETASSVKFAVCGGDGGAFWGVFNVDPQDADAASGVIEDARRAIETAVGAVLRANAVRLRHPLCLALEGVYTHAVAWSQAGVWFWNSRDNTDHLGGFPLRGPAYTTAAGVVRDTLRRVLGLTTACVPEEDALTARGLMEDACDRLILDAFNKRLDAEYWSVRVSPFEASDPLPPTAFRGGALLDAEHYWRRVVRVCPGGGESVGVPVDLYPRPLVLPPVDCAHHLREILREIELVFTGVLAGVWGEGGKFVYPFDDKMSFLFA

Source Source

Source organism organism	Human alphaherpesvirus 1 strain 17
NCBI taxonomy ID ncbi_taxonomy_id	10299
Host organism host_organism	Escherichia coli BL21(DE3)

Entity 4 Entity 4 polymer

Description description	;DNA (5'-D(PTPAPCPAPTPAP*A)-3') ;
Molecular weight formula_weight	7564.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	D

CCACGGCACCTACATAATACATACA

Entity 5 Entity 5 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.200 Å
Low-resolution limit resolution_low	— Å
R factor r_factor	—
R_work r_work	—
R_free r_free	—

Resolution resolution	3.20 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	431843

Composite structure of HSV-1 helicase-primase in complex with a forked DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA replication helicase

State in the Current Structure

Other States of the Same Protein in the Database

DNA primase

State in the Current Structure

Other States of the Same Protein in the Database

DNA helicase/primase complex-associated protein

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9nnp__assembly_1__model_1

9nnp__assembly_1__model_1 | I(q)

9nnp__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)

Composite structure of HSV-1 helicase-primase in complex with a forked DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA replication helicase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA primase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

DNA helicase/primase complex-associated protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9nnp__assembly_1__model_1

9nnp__assembly_1__model_1 | I(q)

9nnp__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

7. Citations (1)