SAXSdb — 2o93

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

actor of activated T-cells, cytoplasmic 2

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 3 DNA 2 PDB declaration: pentameric（5） Consistent with all polymer counts	Chain L； UniProt 392–678 Chain M； UniProt 392–678 Chain O； UniProt 392–678	Fragment：RHR domain	kappaB enhancer element, DNA 25-mer × 1 kappaB enhancer element, DNA 25-mer × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7；291 K；50mM Hepes pH 7.0, 15mM Magnesium Acetate, 250mM Ammonium Acetate, 7.5% PEG 4000, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 3.05 Å R-free 0.283

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 2O93	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1A02 STRUCTURE OF THE DNA BINDING DOMAINS OF NFAT, FOS AND JUN BOUND TO DNA Deposited 1997-12-08	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain N 396–678（283 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；THE COMPLEX WAS CRYSTALLIZED IN 300-400 MM AMMONIUM ACETATE SALT, PH 7.5 (10 MM)., VAPOR DIFFUSION, HANGING DROP	Resolution 2.70 Å R-free 0.303
1OWR CRYSTAL STRUCTURE OF HUMAN NFAT1 BOUND MONOMERICALLY TO DNA Deposited 2003-03-29	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain M 396–678（283 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；289 K；sodium cacodylate, magnesium chloride, peg 3000, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.00 Å R-free 0.273
1OWR CRYSTAL STRUCTURE OF HUMAN NFAT1 BOUND MONOMERICALLY TO DNA Deposited 2003-03-29	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain N 396–678（283 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；289 K；sodium cacodylate, magnesium chloride, peg 3000, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.00 Å R-free 0.273
1OWR CRYSTAL STRUCTURE OF HUMAN NFAT1 BOUND MONOMERICALLY TO DNA Deposited 2003-03-29	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain P 396–678（283 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；289 K；sodium cacodylate, magnesium chloride, peg 3000, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.00 Å R-free 0.273
1OWR CRYSTAL STRUCTURE OF HUMAN NFAT1 BOUND MONOMERICALLY TO DNA Deposited 2003-03-29	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 4 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain Q 396–678（283 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；289 K；sodium cacodylate, magnesium chloride, peg 3000, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.00 Å R-free 0.273
1P7H Structure of NFAT1 bound as a dimer to the HIV-1 LTR kB element Deposited 2003-05-01	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain L 393–678（286 aa） Fragment：NFAT1 Chain M 393–678（286 aa） Fragment：NFAT1	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；291 K；pH 8.1, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.60 Å R-free 0.265
1P7H Structure of NFAT1 bound as a dimer to the HIV-1 LTR kB element Deposited 2003-05-01	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain N 393–678（286 aa） Fragment：NFAT1 Chain O 393–678（286 aa） Fragment：NFAT1	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；291 K；pH 8.1, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.60 Å R-free 0.265
1PZU An asymmetric NFAT1-RHR homodimer on a pseudo-palindromic, Kappa-B site Deposited 2003-07-14	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain B 396–678（283 aa） Fragment：NFAT1 DNA-binding domain Chain D 396–678（283 aa） Fragment：NFAT1 DNA-binding domain	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions MICROBATCH；pH 8；292 K；HEPES, NaCl, glycerol, NH4OAc, MgCl2, spermine, PEG4000, Tris-HCl, pH 8.0, microbatch, temperature 292.0K	Resolution 3.10 Å R-free 0.319
1PZU An asymmetric NFAT1-RHR homodimer on a pseudo-palindromic, Kappa-B site Deposited 2003-07-14	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain H 396–678（283 aa） Fragment：NFAT1 DNA-binding domain Chain I 396–678（283 aa） Fragment：NFAT1 DNA-binding domain	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions MICROBATCH；pH 8；292 K；HEPES, NaCl, glycerol, NH4OAc, MgCl2, spermine, PEG4000, Tris-HCl, pH 8.0, microbatch, temperature 292.0K	Resolution 3.10 Å R-free 0.319
1PZU An asymmetric NFAT1-RHR homodimer on a pseudo-palindromic, Kappa-B site Deposited 2003-07-14	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain L 396–678（283 aa） Fragment：NFAT1 DNA-binding domain Chain M 396–678（283 aa） Fragment：NFAT1 DNA-binding domain	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions MICROBATCH；pH 8；292 K；HEPES, NaCl, glycerol, NH4OAc, MgCl2, spermine, PEG4000, Tris-HCl, pH 8.0, microbatch, temperature 292.0K	Resolution 3.10 Å R-free 0.319
1S9K Crystal Structure of Human NFAT1 and Fos-Jun on the IL-2 ARRE1 Site Deposited 2004-02-04	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain C 399–678（280 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；289 K；300-400 mM Ammonium Acetate Salt, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.10 Å R-free 0.275
2AS5 Structure of the DNA binding domains of NFAT and FOXP2 bound specifically to DNA. Deposited 2005-08-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain N 392–678（287 aa） Fragment：NFAT1 DNA BINDING DOMAIN	Not recorded	MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；291 K；Cacodylic Acid, PEG 4k, Sodium Chloride, Magnesium Chloride, Glycerol, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.70 Å R-free 0.287
2AS5 Structure of the DNA binding domains of NFAT and FOXP2 bound specifically to DNA. Deposited 2005-08-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain M 392–678（287 aa） Fragment：NFAT1 DNA BINDING DOMAIN	Not recorded	MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；291 K；Cacodylic Acid, PEG 4k, Sodium Chloride, Magnesium Chloride, Glycerol, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.70 Å R-free 0.287
3QRF Structure of a domain-swapped FOXP3 dimer Deposited 2011-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain N 396–678（283 aa） Fragment：human NFAT1 DNA Binding Domain	Not recorded	MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.63；291 K；5 mM HEPES, pH 7.63, 2 mM dithiothreitol (DTT), 0.5 mM EDTA, and 150 mM NaCl, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.80 Å R-free 0.283
3QRF Structure of a domain-swapped FOXP3 dimer Deposited 2011-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain M 396–678（283 aa） Fragment：human NFAT1 DNA Binding Domain	Not recorded	MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.63；291 K；5 mM HEPES, pH 7.63, 2 mM dithiothreitol (DTT), 0.5 mM EDTA, and 150 mM NaCl, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.80 Å R-free 0.283
8OW4 2.75 angstrom crystal structure of human NFAT1 with bound DNA Deposited 2023-04-27	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 391–678（288 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；295 K；0.1 M sodium cacodylate pH 6.0, 8% w/v PEG 8000	Resolution 2.75 Å R-free 0.273
8OW4 2.75 angstrom crystal structure of human NFAT1 with bound DNA Deposited 2023-04-27	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 391–678（288 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；295 K；0.1 M sodium cacodylate pH 6.0, 8% w/v PEG 8000	Resolution 2.75 Å R-free 0.273
8R07 C-terminal Rel-homology Domain of NFAT1 Deposited 2023-10-30	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 356–459（104 aa） Chain B 356–459（104 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 6.5；293 K；25% PEG 3350, 200mM Sodium Chloride and 100 mM BIS-TRIS buffer at a pH of 6.5	Resolution 1.74 Å R-free 0.184
8R3F C-terminal Rel-homology Domain of NFAT1 Deposited 2023-11-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 356–459（104 aa） Chain B 356–459（104 aa）	Not recorded	XS8 (4~{S})-6-fluoranyl-3,4-dihydro-2~{H}-chromen-4-amine × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；293 K；containing 25% PEG 3350, 200 mM Sodium Chloride and 100 mM BIS-TRIS buffer at a pH of 6.5	Resolution 1.55 Å R-free 0.236
9VRQ Crystal structure of FOXC2/NFAT1 complex bound to ARRE2 DNA Deposited 2025-07-07	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain N 392–678（287 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；277 K；50 mM MES 5.93, 200 mM NaCl, 10 mM MgCl2, 1 mM TCEP and 12-15% PEG 4K (w/v)	Resolution 2.80 Å R-free 0.288

11 other PDB entries and 20 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	NFAC2_HUMAN
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain L； PDBConstruct 15–301； UniProt 392–678 Author chain M； PDBConstruct 15–301； UniProt 392–678 Author chain O； PDBConstruct 15–301； UniProt 392–678

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2o93
Deposition date deposition_date	2006-12-13
Structure title title	Crystal structure of NFAT bound to the HIV-1 LTR tandem kappaB enhancer element
Keywords keywords	IG domain; Protein-DNA complex; double helix, TRANSCRIPTION-DNA COMPLEX; TRANSCRIPTION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	37.94 Å
Radius of gyration Rg (electron density) rg_electron	38.66 Å
Forward intensity I(0) i0	236737000.00
Molecular weight molecular_weight	112670.0 kDa
Excluded volume excluded_volume	136170 Å³
Envelope volume envelope_volume	196920 Å³
Hydration-shell volume shell_volume	44087 Å³
Envelope diameter envelope_diameter	135.4 Å
Shell Rg shell_rg	42.76 Å
Envelope Rg envelope_rg	37.71 Å
Shape Rg shape_rg	38.69 Å
Total Rg total_rg	38.83 Å
Total atoms total_atoms	7866
Residues n_residues	908
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	127.5 Å
Rg (real space) rg_real	37.91 Å
Rg uncertainty (real space) rg_real_error	1.49 Å
I(0) (real space) i0_real	2.3670e+08
I(0) uncertainty (real space) i0_real_error	4.1250e+06
Rg (reciprocal space) rg_reciprocal	37.93 Å
I(0) (reciprocal space) i0_reciprocal	236700000.0000
Solution quality estimate total_estimate	0.8976
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	45.5 Å
Skewness Skewness skewness	0.228
Kurtosis Kurtosis kurtosis	-0.529
Angular range angular_range	— – 0.2100 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	12040000.0000
Real-space data points n_real_points	43
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.910; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.992; Smooth: 0.941

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Description description	kappaB enhancer element, DNA 25-mer
Molecular weight formula_weight	7681.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	A
Atom count atom_count	7866

AGGGACTTTCCGCTGGGGACTTTCC

Entity 2 Entity 2 polymer

Description description	kappaB enhancer element, DNA 25-mer
Molecular weight formula_weight	7678.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B

TGGAAAGTCCCCAGCGGAAAGTCCC

Entity 3 Entity 3 polymer

Description description	actor of activated T-cells, cytoplasmic 2
Molecular weight formula_weight	34226.9 kDa
Source method src_method	man
Copy count entity_count	3

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	L,M,O

MRGSHHHHHHTAPHASSVPLEWPLSSQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHIPESSGRIVSLQTASNPIECSQRSAHELPMVERQDTDSCLVYGGQQMILTGQNFTSESKVVFTEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRTPVKVNFYVINGKRKRSQPQHFTYHPV

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

▼

7. Fold Classification (SCOP + CATH) 13 domains

SCOP 2.08 (7 domains)

Domain ID domain_id	d2o93l1
Class class	b — All beta proteins
Fold Fold fold	b.1 — Immunoglobulin-like beta-sandwich
Superfamily Superfamily superfamily	b.1.18 — E set domains
Family Family family	b.1.18.1 — NF-kappa-B/REL/DORSAL transcription factors, C-terminal domain

Domain ID domain_id	d2o93l2
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.3 — Rel/Dorsal transcription factors, DNA-binding domain

Domain ID domain_id	d2o93m1
Class class	b — All beta proteins
Fold Fold fold	b.1 — Immunoglobulin-like beta-sandwich
Superfamily Superfamily superfamily	b.1.18 — E set domains
Family Family family	b.1.18.1 — NF-kappa-B/REL/DORSAL transcription factors, C-terminal domain

Domain ID domain_id	d2o93m2
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.3 — Rel/Dorsal transcription factors, DNA-binding domain

Domain ID domain_id	d2o93m3
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

Domain ID domain_id	d2o93o1
Class class	b — All beta proteins
Fold Fold fold	b.1 — Immunoglobulin-like beta-sandwich
Superfamily Superfamily superfamily	b.1.18 — E set domains
Family Family family	b.1.18.1 — NF-kappa-B/REL/DORSAL transcription factors, C-terminal domain

Domain ID domain_id	d2o93o2
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.3 — Rel/Dorsal transcription factors, DNA-binding domain

CATH v4.4 (6 domains)

Domain ID domain_id	2o93L01
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	340 — Rel homology domain (RHD), DNA-binding domain

Domain ID domain_id	2o93L02
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	10 — Immunoglobulins

Domain ID domain_id	2o93M01
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	340 — Rel homology domain (RHD), DNA-binding domain

Domain ID domain_id	2o93M02
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	10 — Immunoglobulins

Domain ID domain_id	2o93O01
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	340 — Rel homology domain (RHD), DNA-binding domain

Domain ID domain_id	2o93O02
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	10 — Immunoglobulins

▶

8. Citations (1)

▶

Unit-cell length a length_a	93.691 Å
Unit-cell length b length_b	95.299 Å
Unit-cell length c length_c	159.227 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	12

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	3.050 Å
Low-resolution limit resolution_low	30.000 Å
R factor r_factor	0.2250
R_work r_work	0.2250
R_free r_free	0.2830

fit	/app/data/saxs_computation/o9/2o93/2o93.fit
pddf	/app/data/pr_computation/o9/2o93/2o93.pr.out
profile	/app/data/saxs_computation/o9/2o93/2o93.dat

Crystal structure of NFAT bound to the HIV-1 LTR tandem kappaB enhancer element

1. Protein Identity and Related Structures Protein Identity & Related Structures

actor of activated T-cells, cytoplasmic 2

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (3)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

来源 Source

7. Fold Classification (SCOP + CATH) 13 domains

SCOP 2.08 (7 domains)

CATH v4.4 (6 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)