3us0

Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair A/T Rich Response Element Containing a Two Base Pair "AT" Spacer Between Half Sites

Method: X-RAY DIFFRACTION D_max: 110.9 Å Quality: EXCELLENT

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tumor protein 63

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 4 DNA 2 PDB declaration: hexameric（6） Consistent with all polymer counts	Chain A； UniProt 166–362 Chain B； UniProt 166–362 Chain C； UniProt 166–362 Chain D； UniProt 166–362	Fragment：DNA binding domain (UNP residues 166-362)	5'-D(APAPAPCPAPTPGPTPTPTPAPTPAPAPAPCPAPTPGPTPTPT)-3' × 2 ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 6.8；298 K；14% PEG3350, 0.2 M ammonium acetate, 0.1 M Bis-Tris, pH 6.8, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.50 Å R-free 0.239

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 3US0	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1RG6 Solution structure of the C-terminal domain of p63 Deposited 2003-11-11	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 501–575（75 aa） Fragment：C-terminal domain (residues 501-575)	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6；298 K；Ionic strength (raw mmCIF value) 150mM NaCl；Pressure ambient NMR measurement conditions pH 6；298 K；Ionic strength (raw mmCIF value) 150mM NaCl；Pressure ambient NMR measurement conditions pH 6；298 K；Ionic strength (raw mmCIF value) 150mM NaCl；Pressure ambient NMR measurement conditions pH 6；298 K；Ionic strength (raw mmCIF value) 150mM NaCl；Pressure ambient NMR sample composition 0.75mM p63 U-15N, 25mM sodium posphate, 150mM sodium chloride, 1mM AEBSF, 3mM DTT, 95% H20, 5%D2O \| 95% H20, 5%D2O NMR sample composition 0.25mM p63 U-15N U-13C, 25mM sodium posphate, 150mM sodium chloride, 1mM AEBSF, 3mM DTT, 95% H20, 5%D2O \| 95% H20, 5%D2O NMR sample composition 0.25mM p63 U-15N U-13C, 25mM sodium posphate, 150mM sodium chloride, 1mM AEBSF, 3mM DTT, 100% D2O \| 100% D2O NMR sample composition 0.75mM p63 U-15N, 25mM sodium posphate, 150mM sodium chloride, 1mM AEBSF, 3mM DTT, phage \| phage	Resolution not provided
2NB1 P63/p73 hetero-tetramerisation domain Deposited 2016-01-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain A 397–455（59 aa） Fragment：Tetramerization domain of 63, UNP residues 397-455 Chain C 397–455（59 aa） Fragment：Tetramerization domain of 63, UNP residues 397-455	Mutation：K21E Mutation：K21E	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 7；310 K；Ionic strength (raw mmCIF value) 75；Pressure ambient NMR measurement conditions pH 6；310 K；Ionic strength (raw mmCIF value) 5；Pressure ambient NMR sample composition 0.5 mM [U-100% 13C; U-100% 15N] p63 tetramerization domain, 0.5 mM p73 tetramerization domain, 25 mM HEPES, 50 mM sodium chloride, 95% H2O/5% D2O \| 95% H2O/5% D2O NMR sample composition 0.5 mM p63 tetramerization domain, 0.5 mM [U-100% 13C; U-100% 15N] p73 tetramerization domain, 25 mM HEPES, 50 mM sodium chloride, 95% H2O/5% D2O \| 95% H2O/5% D2O NMR sample composition 0.5 mM [U-100% 15N] p63 tetramerization domain, 0.5 mM [U-100% 13C] p63 tetramerization domain, 1 mM p73 tetramerization domain, 25 mM HEPES, 50 mM sodium chloride, 95% H2O/5% D2O \| 95% H2O/5% D2O NMR sample composition 1 mM p63 tetramerization domain, 0.5 mM [U-100% 15N] p73 tetramerization domain, 0.5 mM [U-100% 13C] p73 tetramerization domain, 25 mM HEPES, 50 mM sodium chloride, 95% H2O/5% D2O \| 95% H2O/5% D2O NMR sample composition 0.5 mM [U-100% 15N] p63 tetramerization domain, 0.5 mM p73 tetramerization domain, 25 mM HEPES, 50 mM sodium chloride, 100% D2O \| 100% D2O NMR sample composition 0.5 mM p63 tetramerization domain, 0.5 mM [U-100% 15N] p73 tetramerization domain, 25 mM HEPES, 50 mM sodium chloride, 100% D2O \| 100% D2O NMR sample composition 0.5 mM [U-100% 15N] p63 tetramerization domain, 0.5 mM [U-100% 13C] p63 tetramerization domain, 0.5 mM [U-100% 15N] p73 tetramerization domain, 0.5 mM [U-100% 13C] p73 tetramerization domain, 25 mM HEPES, 50 mM sodium chloride, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
2RMN The solution structure of the p63 DNA-binding domain Deposited 2007-11-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 153–384（232 aa） Fragment：DNA binding domain, UNP residues 153-384	Not recorded	ZN ZINC ION × 1	SOLUTION NMR NMR measurement conditions pH 6.8；303 K；Ionic strength (raw mmCIF value) 100；Pressure ambient NMR sample composition 0.7mM [U-15N] p63BDB; 50mM potassium chloride; 50mM potassium phosphate; 5mM DTT; 95% H2O, 5% D2O \| 95% H2O/5% D2O NMR sample composition 0.7mM [U-13C; U-15N] p63BDB; 50mM potassium chloride; 50mM potassium phosphate; 5mM DTT; 95% H2O, 5% D2O \| 95% H2O/5% D2O	Resolution not provided
2Y9T Structural basis of p63a SAM domain mutants involved in AEC syndrome Deposited 2011-02-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 543–622（80 aa） Fragment：SAM DOMAIN, RESIDUES 543-622	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.5；298 K；Ionic strength (raw mmCIF value) 150 NMR sample composition 90% WATER/10% D2O	Resolution not provided
2Y9U Structural basis of p63a SAM domain mutants involved in AEC syndrome Deposited 2011-02-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 545–611（67 aa） Fragment：SAM DOMAIN, RESIDUES 545-611	Not recorded	SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions pH 6.4；100 MM SODIUM CITRATE, PH 6.4, 500MM LITHIUM SULPHATE, 500MM AMMONIUM SULPHATE, 5MM DTT	Resolution 1.60 Å R-free 0.206
3QYM Structure of p63 DNA Binding Domain in Complex with a 10 Base Pair A/T Rich Response Element Half Site Deposited 2011-03-03	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: octameric	Chain A 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain B 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain C 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain D 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362)	Not recorded	ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.8；298 K；10% PEG3350, 0.2 M ammonium formate, 0.1 M Bis-Tris, pH 6.8, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 3.20 Å R-free 0.271
3QYM Structure of p63 DNA Binding Domain in Complex with a 10 Base Pair A/T Rich Response Element Half Site Deposited 2011-03-03	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 4 PDB declaration: octameric	Chain E 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain F 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain G 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain H 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362)	Not recorded	ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.8；298 K；10% PEG3350, 0.2 M ammonium formate, 0.1 M Bis-Tris, pH 6.8, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 3.20 Å R-free 0.271
3QYM Structure of p63 DNA Binding Domain in Complex with a 10 Base Pair A/T Rich Response Element Half Site Deposited 2011-03-03	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Homooligomer；Protein × 4 PDB declaration: octameric	Chain C 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain D 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain E 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain F 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362)	Not recorded	ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.8；298 K；10% PEG3350, 0.2 M ammonium formate, 0.1 M Bis-Tris, pH 6.8, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 3.20 Å R-free 0.271
3QYN Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair A/T Rich Response Element Containing 2 Base Pair Spacer Between Half Sites Deposited 2011-03-03	Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain B 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain C 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain D 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362)	Not recorded	ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.8；298 K；20% PEG3350, 0.2 M ammonium acetate, 0.1 M Bis-Tris, pH 6.8, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.50 Å R-free 0.245
3US1 Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair Response Element Containing a Two Base Pair "GC" Spacer Between Half Sites Deposited 2011-11-22	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain D 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362)	Not recorded	ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.8；298 K；0.2 M ammonium phosphate monobasic, 0.1 M Bis-Tris, pH 6.8, 14% PEG3350, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.80 Å R-free 0.234
3US2 Structure of p63 DNA Binding Domain in Complex with a 19 Base Pair A/T Rich Response Element Containing Two Half Sites with a Single Base Pair Overlap Deposited 2011-11-22	Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain B 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain C 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain D 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362)	Not recorded	ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.8；298 K；0.2 M ammonium formate, 0.1 M Bis-Tris, pH 6.8, 12% PEG3350, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 4.20 Å R-free 0.334
3US2 Structure of p63 DNA Binding Domain in Complex with a 19 Base Pair A/T Rich Response Element Containing Two Half Sites with a Single Base Pair Overlap Deposited 2011-11-22	Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain G 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain H 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain I 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362) Chain J 166–362（197 aa） Fragment：DNA binding domain (UNP residues 166-362)	Not recorded	ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.8；298 K；0.2 M ammonium formate, 0.1 M Bis-Tris, pH 6.8, 12% PEG3350, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 4.20 Å R-free 0.334
3ZY0 Crystal structure of a truncated variant of the human p63 tetramerization domain lacking the C-terminal helix Deposited 2011-08-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 304–333（30 aa） Fragment：TRUNCATED TETRAMERIZATION DOMAIN, RESIDUES 304-333 Chain B 304–333（30 aa） Fragment：TRUNCATED TETRAMERIZATION DOMAIN, RESIDUES 304-333 Chain C 304–333（30 aa） Fragment：TRUNCATED TETRAMERIZATION DOMAIN, RESIDUES 304-333 Chain D 304–333（30 aa） Fragment：TRUNCATED TETRAMERIZATION DOMAIN, RESIDUES 304-333	Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF) Non-standard monomer：Yes (specific site not provided by mmCIF)	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；290 K；SITTING DROP VAPOR DIFFUSION AT 17 DEGREE C. PROTEIN SOLUTION: 12-15 MG/ML IN 20 MM TRIS PH 8.5, 50 MM NACL CRYSTALLIZATION BUFFER: 30% PEG 400, 0.1 M HEPES PH 7.5, 0.2 M MG CHLORIDE.	Resolution 1.90 Å R-free 0.252
3ZY1 Crystal structure of the human p63 tetramerization domain Deposited 2011-08-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 398–441（44 aa） Fragment：TETRAMERIZATION DOMAIN, RESIDUES 398-441	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；290 K；SITTING DROP VAPOR DIFFUSION AT 17 DEGREE C. PROTEIN SOLUTION: 12-15 MG/ML IN 20 MM TRIS PH 8.5, 50 MM NACL CRYSTALLIZATION BUFFER: 10% PEG 8000, 0.1 M HEPES PH 7.5, AND 0.2 M CA ACETATE	Resolution 2.15 Å R-free 0.285
4A9Z CRYSTAL STRUCTURE OF HUMAN P63 TETRAMERIZATION DOMAIN Deposited 2011-11-30	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 397–455（59 aa） Fragment：TETRAMERIZATION DOMAIN, RESIDUES 397-455 Chain B 397–455（59 aa） Fragment：TETRAMERIZATION DOMAIN, RESIDUES 397-455 Chain C 397–455（59 aa） Fragment：TETRAMERIZATION DOMAIN, RESIDUES 397-455 Chain D 397–455（59 aa） Fragment：TETRAMERIZATION DOMAIN, RESIDUES 397-455	Not recorded	PE4 2-{2-[2-(2-{2-[2-(2-ETHOXY-ETHOXY)-ETHOXY]-ETHOXY}-ETHOXY)-ETHOXY]-ETHOXY}-ETHANOL × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 2.29 Å R-free 0.246
6FGN Solution Structure of p300Taz2-p63TA Deposited 2018-01-11	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain A 47–73（27 aa） Fragment：Taz2,transactivation domain	Not recorded	ZN ZINC ION × 3	SOLUTION NMR NMR measurement conditions pH 6.3；303 K；Ionic strength (raw mmCIF value) 200；Pressure AMBIENT NMR sample composition 1200 mM [U-13C; U-15N] Fusion construct of p300 Taz2 and the transactivation domain of p63, 25 mM MES, 200 mM NaCl, 0.5 mM TCEP, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
6RU6 Crystal structure of Casein Kinase I delta (CK1d) in complex with monophosphorylated p63 PAD1P peptide Deposited 2019-05-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain C 618–630（13 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	ACP PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER × 1 NA SODIUM ION × 1 EDO 1,2-ETHANEDIOL × 7	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277.15 K；10-20% PEG 3350, 0.1-0.2 M sodium sulfate and 0.1 M citrate, pH 4.6-5.9	Resolution 2.05 Å R-free 0.257
6RU7 Crystal structure of Casein Kinase I delta (CK1d) in complex with double phosphorylated p63 PAD2P peptide Deposited 2019-05-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain C 618–633（16 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	ADP ADENOSINE-5'-DIPHOSPHATE × 1 EDO 1,2-ETHANEDIOL × 10 NA SODIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277.15 K；10-20% PEG 3350, 0.1-0.2 M sodium sulfate and 0.1 M citrate, pH 4.6-5.9	Resolution 2.08 Å R-free 0.218
6RU7 Crystal structure of Casein Kinase I delta (CK1d) in complex with double phosphorylated p63 PAD2P peptide Deposited 2019-05-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain D 618–633（16 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	ADP ADENOSINE-5'-DIPHOSPHATE × 1 EDO 1,2-ETHANEDIOL × 7	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277.15 K；10-20% PEG 3350, 0.1-0.2 M sodium sulfate and 0.1 M citrate, pH 4.6-5.9	Resolution 2.08 Å R-free 0.218
6RU8 Crystal structure of Casein Kinase I delta (CK1d) in complex with triple phosphorylated p63 PAD3P peptide Deposited 2019-05-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain E 621–632（12 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	ADP ADENOSINE-5'-DIPHOSPHATE × 1 EDO 1,2-ETHANEDIOL × 5 NA SODIUM ION × 1 SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277.15 K；10-20% PEG 3350, 0.1-0.2 M sodium sulfate and 0.1 M citrate, pH 4.6-5.9	Resolution 1.92 Å R-free 0.211
6RU8 Crystal structure of Casein Kinase I delta (CK1d) in complex with triple phosphorylated p63 PAD3P peptide Deposited 2019-05-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain F 621–632（12 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	ADP ADENOSINE-5'-DIPHOSPHATE × 1 EDO 1,2-ETHANEDIOL × 4 NA SODIUM ION × 1 SO4 SULFATE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277.15 K；10-20% PEG 3350, 0.1-0.2 M sodium sulfate and 0.1 M citrate, pH 4.6-5.9	Resolution 1.92 Å R-free 0.211
6RU8 Crystal structure of Casein Kinase I delta (CK1d) in complex with triple phosphorylated p63 PAD3P peptide Deposited 2019-05-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain G 621–632（12 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	ADP ADENOSINE-5'-DIPHOSPHATE × 1 EDO 1,2-ETHANEDIOL × 6	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277.15 K；10-20% PEG 3350, 0.1-0.2 M sodium sulfate and 0.1 M citrate, pH 4.6-5.9	Resolution 1.92 Å R-free 0.211
6RU8 Crystal structure of Casein Kinase I delta (CK1d) in complex with triple phosphorylated p63 PAD3P peptide Deposited 2019-05-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain H 621–632（12 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	ADP ADENOSINE-5'-DIPHOSPHATE × 1 EDO 1,2-ETHANEDIOL × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277.15 K；10-20% PEG 3350, 0.1-0.2 M sodium sulfate and 0.1 M citrate, pH 4.6-5.9	Resolution 1.92 Å R-free 0.211
7Z71 Crystal structure of p63 DBD in complex with darpin C14 Deposited 2022-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 68–269（202 aa）	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293.15 K；25% PEG 3350, 0.2 M sodium chloride, 0.1 M HEPES pH 7.5	Resolution 1.85 Å R-free 0.181
7Z71 Crystal structure of p63 DBD in complex with darpin C14 Deposited 2022-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain C 68–269（202 aa）	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293.15 K；25% PEG 3350, 0.2 M sodium chloride, 0.1 M HEPES pH 7.5	Resolution 1.85 Å R-free 0.181
7Z72 Crystal structure of p63 SAM in complex with darpin A5 Deposited 2022-03-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 460–526（67 aa）	Not recorded	PEG DI(HYDROXYETHYL)ETHER × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 3.5；293.15 K；25% PEG3350, 0.1 M citrate pH 3.5	Resolution 1.80 Å R-free 0.188
7Z73 Crystal structure of p63 tetramerization domain in complex with darpin 8F1 Deposited 2022-03-14	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain A 303–361（59 aa） Chain B 303–361（59 aa） Chain C 303–361（59 aa） Chain D 303–361（59 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.5；293.15 K；25% PEG3350, 0.2 M sodium chloride, 0.1 M bis-tris pH 5.5	Resolution 2.27 Å R-free 0.235
7Z7E Crystal structure of p63 DNA binding domain in complex with inhibitory DARPin G4 Deposited 2022-03-15	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 68–269（202 aa）	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 7.5；295 K；25% PEG 3350 0.2M Li2SO4 0.1M HEPES	Resolution 1.80 Å R-free 0.249
8P9C Crystal structure of p63-p73 heterotetramer (tetramerisation domain) in complex with darpin 1810 F11 Deposited 2023-06-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain A 397–455（59 aa）	Not recorded	EDO 1,2-ETHANEDIOL × 8	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.5；293.15 K；0.2M ammonium acetate, 25% PEG3350, 0.1M HEPES pH 7.5	Resolution 1.76 Å R-free 0.210
8P9D Crystal structure of p63-p73 heterotetramer (tetramerisation domain) in complex with darpin 1810 A2 Deposited 2023-06-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain A 397–455（59 aa） Chain C 397–455（59 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7；293.15 K；20% PEG3350, 0.1M bis-tris propane pH 7.0, 0.2M salicylic, sodium salt	Resolution 2.70 Å R-free 0.252
8P9E Crystal structure of wild type p63-p73 heterotetramer (tetramerisation domain) in complex with darpin 1810 F11 Deposited 2023-06-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: trimeric	Chain A 303–361（59 aa）	Not recorded	GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6.5；293.15 K；0.2M sodium chloride, 25% PEG3350, 0.1M bis-tris pH 6.5	Resolution 2.25 Å R-free 0.250
9GFO iASPP-CTD fusion to p63 peptide Deposited 2024-08-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain AAA 373–381（9 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；2 M sodium formate and 0.1 M TRIS pH 7.5	Resolution 2.40 Å R-free 0.280
9GFO iASPP-CTD fusion to p63 peptide Deposited 2024-08-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain BBB 373–381（9 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；2 M sodium formate and 0.1 M TRIS pH 7.5	Resolution 2.40 Å R-free 0.280
9GFO iASPP-CTD fusion to p63 peptide Deposited 2024-08-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain CCC 373–381（9 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；2 M sodium formate and 0.1 M TRIS pH 7.5	Resolution 2.40 Å R-free 0.280
9GFO iASPP-CTD fusion to p63 peptide Deposited 2024-08-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain DDD 373–381（9 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；2 M sodium formate and 0.1 M TRIS pH 7.5	Resolution 2.40 Å R-free 0.280
9N54 Bipartite p63 NLS in complex with Importin Alpha 2 Deposited 2025-02-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 278–302（25 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；296 K；0.65 M sodium citrate, 0.1 M HEPES and 10 mM DTT	Resolution 2.20 Å R-free 0.206

25 other PDB entries and 36 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	P63_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 7–203； UniProt 166–362 Author chain B； PDBConstruct 7–203； UniProt 166–362 Author chain C； PDBConstruct 7–203； UniProt 166–362 Author chain D； PDBConstruct 7–203； UniProt 166–362

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3us0
Deposition date deposition_date	2011-11-22
Structure title title	Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair A/T Rich Response Element Containing a Two Base Pair "AT" Spacer Between Half Sites
Keywords keywords	B-DNA double helix, zinc binding, beta sandwich, Greek key, transcription factor, nucleus, TRANSCRIPTION ACTIVATOR-DNA complex; TRANSCRIPTION ACTIVATOR/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	35.16 Å
Radius of gyration Rg (electron density) rg_electron	35.67 Å
Forward intensity I(0) i0	188103000.00
Molecular weight molecular_weight	99192.0 kDa
Excluded volume excluded_volume	119330 Å³
Envelope volume envelope_volume	172070 Å³
Hydration-shell volume shell_volume	40489 Å³
Envelope diameter envelope_diameter	125.5 Å
Shell Rg shell_rg	42.15 Å
Envelope Rg envelope_rg	34.60 Å
Shape Rg shape_rg	35.75 Å
Total Rg total_rg	35.86 Å
Total atoms total_atoms	6885
Residues n_residues	820
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	110.9 Å
Rg (real space) rg_real	35.07 Å
Rg uncertainty (real space) rg_real_error	0.78 Å
I(0) (real space) i0_real	1.8810e+08
I(0) uncertainty (real space) i0_real_error	2.8550e+06
Rg (reciprocal space) rg_reciprocal	35.13 Å
I(0) (reciprocal space) i0_reciprocal	188100000.0000
Solution quality estimate total_estimate	0.9016
Solution quality rating solution_quality	EXCELLENT a EXCELLENT solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	51.8 Å
Skewness Skewness skewness	0.114
Kurtosis Kurtosis kurtosis	-0.663
Angular range angular_range	— – 0.2250 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	38190000.0000
Real-space data points n_real_points	46
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.927; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.994; Smooth: 0.942

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Tumor protein 63
Molecular weight formula_weight	22683.9 kDa
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D
Atom count atom_count	7279

GSHMASPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQ

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	5'-D(APAPAPCPAPTPGPTPTPTPAPTPAPAPAPCPAPTPGPTPTPT)-3'
Molecular weight formula_weight	6748.4 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E,F

AAACATGTTTATAAACATGTTT

Entity 3 Entity 3 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	394

▼

7. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (8 domains)

Domain ID domain_id	d3us0a1
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.2 — p53 DNA-binding domain-like

Domain ID domain_id	d3us0a2
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

Domain ID domain_id	d3us0b1
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.2 — p53 DNA-binding domain-like

Domain ID domain_id	d3us0b2
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

Domain ID domain_id	d3us0c1
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.2 — p53 DNA-binding domain-like

Domain ID domain_id	d3us0c2
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

Domain ID domain_id	d3us0d1
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.2 — p53 DNA-binding domain-like

Domain ID domain_id	d3us0d2
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

CATH v4.4 (4 domains)

Domain ID domain_id	3us0A00
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	720 —

Domain ID domain_id	3us0B00
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	720 —

Domain ID domain_id	3us0C00
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	720 —

Domain ID domain_id	3us0D00
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	720 —

▶

8. Citations (1)

▶

Unit-cell length a length_a	141.806 Å
Unit-cell length b length_b	141.806 Å
Unit-cell length c length_c	119.604 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	120.00 °
Molecules per unit cell Z z_pdb	24

Space group space_group	P 63
Space-group number int_tables_number	173
Crystal system crystal_system	—

Resolution resolution	2.500 Å
Low-resolution limit resolution_low	59.802 Å
R factor r_factor	0.2077
R_work r_work	0.2060
R_free r_free	0.2389

fit	/app/data/saxs_computation/us/3us0/3us0.fit
pddf	/app/data/pr_computation/us/3us0/3us0.pr.out
profile	/app/data/saxs_computation/us/3us0/3us0.dat

Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair A/T Rich Response Element Containing a Two Base Pair "AT" Spacer Between Half Sites

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tumor protein 63

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

7. Fold Classification (SCOP + CATH) 12 domains

SCOP 2.08 (8 domains)

CATH v4.4 (4 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)