SAXSdb — 3us1

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tumor protein 63

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 4 DNA 2	5'-D(APAPAPCPAPTPGPTPTPTPGPCPAPAPAPCPAPTPGPTPTPT)-3' × 2 ZINC ION × 4 water × 6	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	P63_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 7–203； UniProt 166–362 Author chain D； PDBConstruct 7–203； UniProt 166–362

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3us1
Deposition date deposition_date	2011-11-22
Structure title title	Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair Response Element Containing a Two Base Pair "GC" Spacer Between Half Sites
Keywords keywords	B-DNA double helix, zinc binding, beta sandwich, Greek key, transcription factor, nucleus, TRANSCRIPTION ACTIVATOR-DNA complex; TRANSCRIPTION ACTIVATOR/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

3us1__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

3us1__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

3us1__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	31.94 Å
Rg (electron density)	32.07 Å
Total Rg	32.39 Å
Atom count	6728
Residues	794
Excluded volume	116490 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`3us1__assembly_1__model_1`	hexameric （6）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Tumor protein 63
Molecular weight formula_weight	22683.9 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,D
Atom count atom_count	3538

GSHMASPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQ

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	5'-D(APAPAPCPAPTPGPTPTPTPGPCPAPAPAPCPAPTPGPTPTPT)-3'
Molecular weight formula_weight	6749.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

AAACATGTTTGCAAACATGTTT

Entity 3 Entity 3 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	174

▼

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (3 domains)

Domain ID domain_id	d3us1a1
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.2 — p53 DNA-binding domain-like

Domain ID domain_id	d3us1a2
Class class	l — Artifacts
Fold Fold fold	l.1 — Tags
Superfamily Superfamily superfamily	l.1.1 — Tags
Family Family family	l.1.1.1 — Tags

Domain ID domain_id	d3us1d_
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.2 — p53 DNA-binding domain-like

CATH v4.4 (2 domains)

Domain ID domain_id	3us1A00
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	720 —

Domain ID domain_id	3us1D00
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	720 —

▶

Unit-cell length a length_a	84.954 Å
Unit-cell length b length_b	101.220 Å
Unit-cell length c length_c	71.501 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	122.78 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	C 1 2 1
Space-group number int_tables_number	5
Crystal system crystal_system	—

Resolution resolution	2.800 Å
Low-resolution limit resolution_low	19.610 Å
R factor r_factor	0.2044
R_work r_work	0.2015
R_free r_free	0.2336

Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair Response Element Containing a Two Base Pair "GC" Spacer Between Half Sites

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tumor protein 63

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3us1__assembly_1__model_1

3us1__assembly_1__model_1 | I(q)

3us1__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (3 domains)

CATH v4.4 (2 domains)

7. Citations (1)

Structure of p63 DNA Binding Domain in Complex with a 22 Base Pair Response Element Containing a Two Base Pair "GC" Spacer Between Half Sites

1. Protein Identity and Related Structures Protein Identity & Related Structures

Tumor protein 63

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

3us1__assembly_1__model_1

3us1__assembly_1__model_1 | I(q)

3us1__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

6. Fold Classification (SCOP + CATH) 5 domains

SCOP 2.08 (3 domains)

CATH v4.4 (2 domains)

7. Citations (1)