SAXSdb — 4ric

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Fanconi-associated nuclease 1

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Monomer Protein × 1 DNA 3 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain A； UniProt 370–1009	Fragment：unp residues 370-1009	;DNA (5'-D(TPTPAPGPCPCPAPCPGPCPCPTPAPGPAPCPTPCPCPTPC)-3') ; × 1 ;DNA (5'-D(GPCPTPGPAPGPGPAPGPTPCPT)-3') ; × 1 ;DNA (5'-D(TPTPTPTPTPTPGPAPGPGPCPGPTP*G)-3') ; × 1 CA CALCIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl , pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.80 Å R-free 0.257
2	Protein–DNA Monomer Protein × 1 DNA 3 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain B； UniProt 370–1009	Fragment：unp residues 370-1009	;DNA (5'-D(TPTPAPGPCPCPAPCPGPCPCPTPAPGPAPCPTPCPCPTPC)-3') ; × 1 ;DNA (5'-D(GPCPTPGPAPGPGPAPGPTPCPT)-3') ; × 1 ;DNA (5'-D(TPTPTPTPTPTPGPAPGPGPCPGPTP*G)-3') ; × 1 CA CALCIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl , pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.80 Å R-free 0.257

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 4RIC	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
4REA A Nuclease DNA complex Deposited 2014-09-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: pentameric	Chain A 373–1017（645 aa） Fragment：UNP residues 373-1017 Chain B 373–1017（645 aa） Fragment：UNP residues 373-1017	Mutation：D960A Mutation：D960A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions micro-batch under oil；300 K；0.1-0.2M KSCN, 18-22% PEG 3350, 0.1M BisTris-propane, micro-batch under oil, temperature 300K	Resolution 3.81 Å R-free 0.277
4REB Structural Insights into 5' Flap DNA Unwinding and Incision by the Human FAN1 Dimer Deposited 2014-09-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: pentameric	Chain A 373–1017（645 aa） Fragment：UNP residues 373-1017 Chain H 373–1017（645 aa） Fragment：UNP residues 373-1017	Mutation：D960A Mutation：D960A	SM SAMARIUM (III) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions micro-batch under oil；300 K；0.1mM spermidine, 1% 1,6-Hexanediol, 22-24% PEG 3350, 0.1M BisTris Propane, micro-batch under oil, temperature 300K	Resolution 4.20 Å R-free 0.262
4REC A nuclease-DNA complex form 3 Deposited 2014-09-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: trimeric	Chain A 373–1017（645 aa） Fragment：UNP residues 373-1017	Mutation：D960A	IOD IODIDE ION × 6	X-RAY DIFFRACTION X-ray crystallization conditions micro-batch under oil；300 K；0.1M potassium iodide, 0.1mM spermidine, 18% PEG3350, 0.1M BisTris propane, micro-batch under oil, temperature 300K	Resolution 2.20 Å R-free 0.254
4RI8 FAN1 Nuclease bound to 5' phosphorylated p(dG)/3'(dT-dT-dT-dT) double flap DNA Deposited 2014-10-05	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 370–1017（648 aa） Fragment：unp residues 370-1017	Mutation：V487A	CA CALCIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl, pH 7.0, hanging drop vapor diffusion, temperature 277K, VAPOR DIFFUSION, HANGING DROP	Resolution 2.90 Å R-free 0.255
4RI8 FAN1 Nuclease bound to 5' phosphorylated p(dG)/3'(dT-dT-dT-dT) double flap DNA Deposited 2014-10-05	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 370–1017（648 aa） Fragment：unp residues 370-1017	Mutation：V487A	CA CALCIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl, pH 7.0, hanging drop vapor diffusion, temperature 277K, VAPOR DIFFUSION, HANGING DROP	Resolution 2.90 Å R-free 0.255
4RI9 FAN1 Nuclease bound to 5' phosphorylated p(dT)/3'(dT-dT-dT-dT-dT-dT-dT-dT) double flap DNA Deposited 2014-10-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: pentameric	Chain A 370–1017（648 aa） Fragment：unp residues 370-1017	Mutation：V487A	BA BARIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.90 Å R-free 0.266
4RI9 FAN1 Nuclease bound to 5' phosphorylated p(dT)/3'(dT-dT-dT-dT-dT-dT-dT-dT) double flap DNA Deposited 2014-10-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: pentameric	Chain B 370–1017（648 aa） Fragment：unp residues 370-1017	Mutation：V487A	BA BARIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.90 Å R-free 0.266
4RIA FAN1 Nuclease bound to 5' phosphorylated nicked DNA Deposited 2014-10-05	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: pentameric	Chain A 370–1017（648 aa） Fragment：unp residues 370-1017	Not recorded	BA BARIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl , pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 3.00 Å R-free 0.267
4RIA FAN1 Nuclease bound to 5' phosphorylated nicked DNA Deposited 2014-10-05	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: pentameric	Chain B 370–1017（648 aa） Fragment：unp residues 370-1017	Not recorded	BA BARIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl , pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 3.00 Å R-free 0.267
4RIB FAN1 Nuclease bound to 5' phosphorylated p(dT) single flap DNA Deposited 2014-10-05	Different construct Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 364–1017（654 aa） Fragment：unp residues 364-1017	Not recorded	CA CALCIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions hanging drop vapor diffusion；pH 7；277 K；PEG 3350, NaCl, pH 7.0, hanging drop vapor diffusion, temperature 277K	Resolution 3.25 Å R-free 0.265
4RIB FAN1 Nuclease bound to 5' phosphorylated p(dT) single flap DNA Deposited 2014-10-05	Different construct Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 364–1017（654 aa） Fragment：unp residues 364-1017	Not recorded	CA CALCIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions hanging drop vapor diffusion；pH 7；277 K；PEG 3350, NaCl, pH 7.0, hanging drop vapor diffusion, temperature 277K	Resolution 3.25 Å R-free 0.265
4RID Human FAN1 nuclease Deposited 2014-10-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 370–1009（640 aa） Fragment：unp residues 370-1009	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 3.30 Å R-free 0.288
4RID Human FAN1 nuclease Deposited 2014-10-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 370–1009（640 aa） Fragment：unp residues 370-1009	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 3.30 Å R-free 0.288
4RID Human FAN1 nuclease Deposited 2014-10-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 370–1009（640 aa） Fragment：unp residues 370-1009 Chain B 370–1009（640 aa） Fragment：unp residues 370-1009	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；277 K；PEG 3350, NaCl, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 3.30 Å R-free 0.288
4RY3 Crystal structure of human Fanconi-associated nuclease 1 Deposited 2014-12-13	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 371–1010（640 aa） Fragment：UNP residues 371-1010	Not recorded	PT PLATINUM (II) ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.2；277 K；2.5M sodium acetate, 0.1M Bis-Tris propane, 10% glycerol, pH 8.2, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.80 Å R-free 0.243
4RY3 Crystal structure of human Fanconi-associated nuclease 1 Deposited 2014-12-13	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 371–1010（640 aa） Fragment：UNP residues 371-1010	Not recorded	PT PLATINUM (II) ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.2；277 K；2.5M sodium acetate, 0.1M Bis-Tris propane, 10% glycerol, pH 8.2, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.80 Å R-free 0.243
8S5A The crystal structure of FAN1 Nuclease bound to 5' phosphorylated p(dG)/3'(dT-dT-dT-dT) double flap DNA Deposited 2024-02-23	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 364–1017（654 aa）	Not recorded	CA CALCIUM ION × 2 CL CHLORIDE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；293 K；0.1 M Hepes/MOPS pH: 7.25, 0.1M Sodium formate 0.1M Ammonium acetate 0.1M Sodium citrate tribasic dihydrate 0.1M Potassium sodium tartrate tetrahydrate 0.1M Sodium oxamate 21% v/v Ethylene glycol 21 % w/v PEG 8000	Resolution 2.65 Å R-free 0.273
9CG4 Cryo-EM structure of FAN1, PCNA and DNA substrate with (CAG)2 extrusion in intermediate state Deposited 2024-06-28	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain E 372–554（183 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.37 Å
9CHM Cryo-EM structure of FAN1 R507H and PCNA in intermediate state Deposited 2024-07-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain E 372–555（184 aa）	Mutation：R507H	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.47 Å
9CL7 Cryo-EM structure of FAN1-PCNA-DNA in final state Deposited 2024-07-10	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain E 372–1010（639 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.83 Å
9CMA Cryo-EM structure of FAN1 R507H-PCNA-DNA in final state Deposited 2024-07-13	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain A 372–1017（646 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.97 Å
9EO1 Cryo_EM structure of human FAN1 in complex with 5' flap DNA substrate Deposited 2024-03-14	Different construct Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 372–1007（636 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 3.20 Å
9EOA Cryo_EM structure of human FAN1 in complex with 5' flap DNA substrate and PCNA Deposited 2024-03-14	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: heptameric	Chain A 372–1007（636 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 3.27 Å
9GY0 Cryo_EM structure of human FAN1 R507H mutant in complex with 5' flap DNA substrate and PCNA Deposited 2024-10-01	Different construct Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: heptameric	Chain A 1–1017（1017 aa）	Not recorded	CA CALCIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 3.42 Å

17 other PDB entries and 24 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	FAN1_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–631； UniProt 370–1009 Author chain B； PDBConstruct 1–631； UniProt 370–1009

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	4ric
Deposition date deposition_date	2014-10-05
Structure title title	FAN1 Nuclease bound to 5' hydroxyl (dT-dT) single flap DNA
Keywords keywords	nuclease, hydrolase-dna complex; hydrolase/dna
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	45.81 Å
Radius of gyration Rg (electron density) rg_electron	46.48 Å
Forward intensity I(0) i0	483377000.00
Molecular weight molecular_weight	165900.0 kDa
Excluded volume excluded_volume	201370 Å³
Envelope volume envelope_volume	311620 Å³
Hydration-shell volume shell_volume	58125 Å³
Envelope diameter envelope_diameter	149.4 Å
Shell Rg shell_rg	48.61 Å
Envelope Rg envelope_rg	44.99 Å
Shape Rg shape_rg	46.51 Å
Total Rg total_rg	46.49 Å
Total atoms total_atoms	11571
Residues n_residues	1321
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	153.3 Å
Rg (real space) rg_real	46.04 Å
Rg uncertainty (real space) rg_real_error	1.78 Å
I(0) (real space) i0_real	4.8340e+08
I(0) uncertainty (real space) i0_real_error	9.6850e+06
Rg (reciprocal space) rg_reciprocal	45.81 Å
I(0) (reciprocal space) i0_reciprocal	483200000.0000
Solution quality estimate total_estimate	0.8131
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	45.1 Å
Skewness Skewness skewness	0.381
Kurtosis Kurtosis kurtosis	-0.607
Angular range angular_range	— – 0.1700 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	39610000.0000
Real-space data points n_real_points	35
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.868; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.961; Smooth: 0.000

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Description description	Fanconi-associated nuclease 1
Molecular weight formula_weight	71983.9 kDa
EC 编号 ec_number	3.1.21.-, 3.1.4.1
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	11571

TGHPYYLRSFLVVLKTVLENEDDMLLFDEQEKGIVTKFYQLSATGQKLYVRLFQRKLSWIKMTKLEYEEIALDLTPVIEELTNAGFLQTESELQELSEVLELLSAPELKSLAKTFHLVNPNGQKQQLVDAFLKLAKQRSVIGAVILKRAKALAGQSVRICKGPRAVFSRILLLFSLTDSMEDEDAACGGQGQLSTVLLVNLGRMEFPSYTINRKTHIFQDRDDLIRYAAATHMLSDISSAMANGNWEEAKELAQCAKRDWNRLKNHPSLRCHEDLPLFLRCFTVGWIYTRILSRFVEILQRLHMYEEAVRELESLLSQRIYCPDSRGRWWDRLALNLHQHLKRLEPTIKCITEGLADPEVRTGHRLSLYQRAVRLRESPSCKKFKHLFQQLPEMAVQDVKHVTITGRLCPQRGMCKSVFVMEAGEAADPTTVLCSVEELALAHYRRSGFDQGIHGEGSTFSTLYGLLLWDIIFMDGIPDVFRNACQAFPLDLCTDSFFTSRRPALEARLQLIHDAPEESLRAWVAATWHEQEGRVASLVSWDRFTSLQQAQDLVSCLGGPVLSGVCRHLAADFRHCRGGLPDLVVWNSQSRHFKLVEVKGPNDRLSHKQMIWLAELQKLGAEVEVCHVVAV

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(TPTPAPGPCPCPAPCPGPCPCPTPAPGPAPCPTPCPCPTP*C)-3') ;
Molecular weight formula_weight	6319.1 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	X,U

TTAGCCACGCCTAGACTCCTC

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(GPCPTPGPAPGPGPAPGPTPCPT)-3') ;
Molecular weight formula_weight	3718.4 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	Y,V

GCTGAGGAGTCT

Entity 4 Entity 4 polymer

Description description	;DNA (5'-D(TPTPTPTPTPTPGPAPGPGPCPGPTPG)-3') ;
Molecular weight formula_weight	4332.8 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	W,T

TTTTTTGAGGCGTG

Entity 5 Entity 5 non-polymer

Description description	CALCIUM ION
Molecular weight formula_weight	40.1 kDa
Source method src_method	syn
Copy count entity_count	2

▶

8. Citations (1)

▶

Unit-cell length a length_a	97.697 Å
Unit-cell length b length_b	110.989 Å
Unit-cell length c length_c	105.427 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	103.75 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.800 Å
Low-resolution limit resolution_low	50.000 Å
R factor r_factor	0.2239
R_work r_work	0.2225
R_free r_free	0.2571

fit	/app/data/saxs_computation/ri/4ric/4ric.fit
pddf	/app/data/pr_computation/ri/4ric/4ric.pr.out
profile	/app/data/saxs_computation/ri/4ric/4ric.dat

FAN1 Nuclease bound to 5' hydroxyl (dT-dT) single flap DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

Fanconi-associated nuclease 1

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (5)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)