7yi2

Cryo-EM structure of Rpd3S in loose-state Rpd3S-NCP complex

Method: ELECTRON MICROSCOPY D_max: 128.5 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Transcriptional regulatory protein SIN3

Saccharomyces cerevisiae S288C

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Heteromer Protein × 5 DNA 2 PDB declaration: heptameric（7） Consistent with all polymer counts	Chain A； UniProt 1–1536	Not recorded	Wisdom 601 DNA (167-MER) × 1 Wisdom 601 DNA (167-MER) × 1 Histone deacetylase RPD3 × 1 （P32561） Chromatin modification-related protein EAF3 × 1 （Q12432） Transcriptional regulatory protein RCO1 × 2 （Q04779） ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.40 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 7YI2	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
6XAW Crystal Structure Analysis of SIN3-UME6 Deposited 2020-06-04	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 402–473（72 aa）	Not recorded	BR BROMIDE ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.8；293 K；100mM Tris, pH 8.8, 1.36M sodium citrate	Resolution 1.84 Å R-free 0.212
6XDJ Crystal Structure Analysis of MBP-SIN3 Deposited 2020-06-10	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain A 402–473（72 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；0.1M Bis-Tris, pH 6.0, 1.6M Ammonium sulfate	Resolution 2.20 Å R-free 0.240
6XDJ Crystal Structure Analysis of MBP-SIN3 Deposited 2020-06-10	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain B 402–473（72 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；0.1M Bis-Tris, pH 6.0, 1.6M Ammonium sulfate	Resolution 2.20 Å R-free 0.240
6XDJ Crystal Structure Analysis of MBP-SIN3 Deposited 2020-06-10	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain C 402–473（72 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；0.1M Bis-Tris, pH 6.0, 1.6M Ammonium sulfate	Resolution 2.20 Å R-free 0.240
6XDJ Crystal Structure Analysis of MBP-SIN3 Deposited 2020-06-10	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain D 402–473（72 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；0.1M Bis-Tris, pH 6.0, 1.6M Ammonium sulfate	Resolution 2.20 Å R-free 0.240
7YI0 Cryo-EM structure of Rpd3S complex Deposited 2022-07-14	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain A 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
7YI3 Cryo-EM structure of Rpd3S in close-state Rpd3S-NCP complex Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 5 PDB declaration: pentameric	Chain A 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
7YI4 Cryo-EM structure of Rpd3S complex bound to H3K36me3 nucleosome in close state Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain A 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.96 Å
7YI5 Cryo-EM structure of Rpd3S complex bound to H3K36me3 nucleosome in loose state Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain A 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.96 Å
8GA8 Structure of the yeast (HDAC) Rpd3L complex Deposited 2023-02-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 10 PDB declaration: decameric	Chain A 1–1536（1536 aa） Chain D 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.9 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.50 Å
8HPO Cryo-EM structure of a SIN3/HDAC complex from budding yeast Deposited 2022-12-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 11 PDB declaration: undecameric	Chain A 1–1536（1536 aa） Chain B 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 2 K POTASSIUM ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.60 Å
8HXX Cryo-EM structure of the histone deacetylase complex Rpd3S Deposited 2023-01-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 7 PDB declaration: heptameric	Chain K 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES-Na pH 7.5, 40 mM KCl, 2 mM MgCl2, 1 mM TCEP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
8HXY Cryo-EM structure of the histone deacetylase complex Rpd3S in complex with nucleosome Deposited 2023-01-05	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 13 PDB declaration: pentadecameric	Chain K 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES-Na pH 7.5, 40 mM KCl, 2 mM MgCl2, 1 mM TCEP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
8HY0 Composite cryo-EM structure of the histone deacetylase complex Rpd3S in complex with nucleosome Deposited 2023-01-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain K 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES-Na pH 7.5, 40 mM KCl, 2 mM MgCl2, 1 mM TCEP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
8IHN Cryo-EM structure of the Rpd3S core complex Deposited 2023-02-23	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 7 PDB declaration: heptameric	Chain K 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 1 CA CALCIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.37 Å
8IHT Rpd3S bound to the nucleosome Deposited 2023-02-23	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain K 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 1 CA CALCIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.72 Å
8JHO Cryo-EM structure of the histone deacetylase complex Rpd3S in complex with di-nucleosome Deposited 2023-05-25	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 22 PDB declaration: 24-meric	Chain K 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES-Na pH 7.5, 40 mM KCl, 2 mM MgCl2, 1 mM TCEP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 7.60 Å
8KC7 Rpd3S histone deacetylase complex Deposited 2023-08-06	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain B 215–1536（1322 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.46 Å
8KD2 Rpd3S in complex with 187bp nucleosome Deposited 2023-08-09	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain B 2–1536（1535 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.02 Å
8KD3 Rpd3S in complex with nucleosome with H3K36MLA modification, H3K9Q mutation and 187bp DNA Deposited 2023-08-09	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain B 2–1536（1535 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8KD4 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class1 Deposited 2023-08-09	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain B 215–1536（1322 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.93 Å
8KD5 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class2 Deposited 2023-08-09	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: 16-meric	Chain B 2–1536（1535 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8KD6 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class3 Deposited 2023-08-09	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain B 215–1536（1322 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.07 Å
8KD7 Rpd3S in complex with nucleosome with H3K36MLA modification and 167bp DNA Deposited 2023-08-09	Different construct Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain B 215–1536（1322 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.09 Å
8TOF Rpd3S bound to an H3K36Cme3 modified nucleosome Deposited 2023-08-03	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 16 PDB declaration: octadecameric	Chain A 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
8W9C Cryo-EM structure of the Rpd3S complex from budding yeast Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain A 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
8W9D Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 1 Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 16 PDB declaration: 18-meric	Chain A 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å
8W9E Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 2 Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 15 PDB declaration: 17-meric	Chain A 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.60 Å
8W9F Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 3 Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 15 PDB declaration: 17-meric	Chain A 1–1536（1536 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.40 Å
9V2V Cryo-EM structure of the histone deacetylase complex Rpd3L in complex with mono-nucleosome Deposited 2025-05-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 19 PDB declaration: 21-meric	Chain A 662–1344（683 aa） Chain B 662–1344（683 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
9V2W Cryo-EM structure of the histone deacetylase complex Rpd3L in complex with di-nucleosome Deposited 2025-05-21	Different construct Different oligomeric state Different ligand/ion	Assembly 1 Protein–DNA Heteromer；Protein × 24 PDB declaration: 26-meric	Chain A 225–1320（1096 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å

28 other PDB entries and 31 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	SIN3_YEAST
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–1536； UniProt 1–1536

Histone deacetylase RPD3

Saccharomyces cerevisiae S288C

UniProt P32561

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Heteromer Protein × 5 DNA 2 PDB declaration: heptameric（7） Consistent with all polymer counts	Chain B； UniProt 1–433	Not recorded	Wisdom 601 DNA (167-MER) × 1 Wisdom 601 DNA (167-MER) × 1 Transcriptional regulatory protein SIN3 × 1 （P22579） Chromatin modification-related protein EAF3 × 1 （Q12432） Transcriptional regulatory protein RCO1 × 2 （Q04779） ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.40 Å

Other States of the Same Protein in the Database

Other PDB	Difference from Current Entry 7YI2	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
7YI0 Cryo-EM structure of Rpd3S complex Deposited 2022-07-14	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain B 1–433（433 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
7YI3 Cryo-EM structure of Rpd3S in close-state Rpd3S-NCP complex Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 5 PDB declaration: pentameric	Chain B 1–433（433 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
7YI4 Cryo-EM structure of Rpd3S complex bound to H3K36me3 nucleosome in close state Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain B 1–433（433 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.96 Å
7YI5 Cryo-EM structure of Rpd3S complex bound to H3K36me3 nucleosome in loose state Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain B 1–433（433 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.96 Å
8GA8 Structure of the yeast (HDAC) Rpd3L complex Deposited 2023-02-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 10 PDB declaration: decameric	Chain B 1–433（433 aa） Chain E 1–433（433 aa）	Not recorded	ZN ZINC ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.9 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.50 Å
8HPO Cryo-EM structure of a SIN3/HDAC complex from budding yeast Deposited 2022-12-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 11 PDB declaration: undecameric	Chain F 1–433（433 aa） Chain G 1–433（433 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	ZN ZINC ION × 2 K POTASSIUM ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.60 Å
8HXX Cryo-EM structure of the histone deacetylase complex Rpd3S Deposited 2023-01-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 7 PDB declaration: heptameric	Chain L 1–433（433 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES-Na pH 7.5, 40 mM KCl, 2 mM MgCl2, 1 mM TCEP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
8HXY Cryo-EM structure of the histone deacetylase complex Rpd3S in complex with nucleosome Deposited 2023-01-05	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 13 PDB declaration: pentadecameric	Chain L 1–433（433 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES-Na pH 7.5, 40 mM KCl, 2 mM MgCl2, 1 mM TCEP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
8HY0 Composite cryo-EM structure of the histone deacetylase complex Rpd3S in complex with nucleosome Deposited 2023-01-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain L 1–433（433 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES-Na pH 7.5, 40 mM KCl, 2 mM MgCl2, 1 mM TCEP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
8IHN Cryo-EM structure of the Rpd3S core complex Deposited 2023-02-23	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 7 PDB declaration: heptameric	Chain L 1–433（433 aa）	Not recorded	ZN ZINC ION × 1 CA CALCIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.37 Å
8IHT Rpd3S bound to the nucleosome Deposited 2023-02-23	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain L 1–433（433 aa）	Not recorded	ZN ZINC ION × 1 CA CALCIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.72 Å
8JHO Cryo-EM structure of the histone deacetylase complex Rpd3S in complex with di-nucleosome Deposited 2023-05-25	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 22 PDB declaration: 24-meric	Chain L 1–433（433 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5；20 mM HEPES-Na pH 7.5, 40 mM KCl, 2 mM MgCl2, 1 mM TCEP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 7.60 Å
8KC7 Rpd3S histone deacetylase complex Deposited 2023-08-06	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain A 1–433（433 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.46 Å
8KD2 Rpd3S in complex with 187bp nucleosome Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain A 1–433（433 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.02 Å
8KD3 Rpd3S in complex with nucleosome with H3K36MLA modification, H3K9Q mutation and 187bp DNA Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain A 1–433（433 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8KD4 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class1 Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain A 1–433（433 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.93 Å
8KD5 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class2 Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: 16-meric	Chain A 1–433（433 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8KD6 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class3 Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain A 1–433（433 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.07 Å
8KD7 Rpd3S in complex with nucleosome with H3K36MLA modification and 167bp DNA Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain A 1–433（433 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.09 Å
8TOF Rpd3S bound to an H3K36Cme3 modified nucleosome Deposited 2023-08-03	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 16 PDB declaration: octadecameric	Chain B 1–433（433 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
8W9C Cryo-EM structure of the Rpd3S complex from budding yeast Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain B 1–433（433 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
8W9D Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 1 Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 16 PDB declaration: 18-meric	Chain B 1–433（433 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å
8W9E Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 2 Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 15 PDB declaration: 17-meric	Chain B 1–433（433 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.60 Å
8W9F Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 3 Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 15 PDB declaration: 17-meric	Chain B 1–433（433 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.40 Å
9V2V Cryo-EM structure of the histone deacetylase complex Rpd3L in complex with mono-nucleosome Deposited 2025-05-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 19 PDB declaration: 21-meric	Chain C 9–393（385 aa） Chain D 9–393（385 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
9V2W Cryo-EM structure of the histone deacetylase complex Rpd3L in complex with di-nucleosome Deposited 2025-05-21	Different construct Different oligomeric state Different ligand/ion	Assembly 1 Protein–DNA Heteromer；Protein × 24 PDB declaration: 26-meric	Chain C 9–386（378 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å

26 other PDB entries and 26 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	RPD3_YEAST
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain B； PDBConstruct 1–433； UniProt 1–433

Chromatin modification-related protein EAF3

Saccharomyces cerevisiae S288C

UniProt Q12432

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Heteromer Protein × 5 DNA 2 PDB declaration: heptameric（7） Consistent with all polymer counts	Chain C； UniProt 1–401	Not recorded	Wisdom 601 DNA (167-MER) × 1 Wisdom 601 DNA (167-MER) × 1 Transcriptional regulatory protein SIN3 × 1 （P22579） Histone deacetylase RPD3 × 1 （P32561） Transcriptional regulatory protein RCO1 × 2 （Q04779） ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.40 Å

Other States of the Same Protein in the Database

Other PDB	Difference from Current Entry 7YI2	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
2K3X Solution structure of EAF3 chromo barrel domain Deposited 2008-05-19	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–113（113 aa） Fragment：UNP residues 1 to 113	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.7；300 K；Ionic strength (raw mmCIF value) 50；Pressure ambient NMR sample composition 0.4-1.5 mM [U-100% 15N] Eaf3, 20 mM sodium phosphate, 50 mM sodium chloride, 1 mM EDTA, 2 mM DTT, 800 mM urea, 93% H2O/7% D2O \| 93% H2O/7% D2O NMR sample composition 0.4-1.5 mM [U-100% 13C; U-100% 15N] Eaf3, 20 mM sodium phosphate, 50 mM sodium chloride, 1 mM EDTA, 2 mM DTT, 800 mM urea, 93% H2O/7% D2O \| 93% H2O/7% D2O	Resolution not provided
2K3Y Solution structure of EAF3 chromo barrel domain bound to histone h3 with a dimethyllysine analog H3K36ME2 Deposited 2008-05-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–115（115 aa） Fragment：UNP residues 1 to 115	Non-standard monomer：Yes (specific site not provided by mmCIF)	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.7；300 K；Ionic strength (raw mmCIF value) 50；Pressure ambient NMR sample composition 0.4-1.5 mM [U-100% 15N] entity, 20 mM sodium phosphate, 50 mM sodium chloride, 1 mM EDTA, 2 mM DTT, 93% H2O/7% D2O \| 93% H2O/7% D2O NMR sample composition 0.4-1.5 mM [U-100% 13C; U-100% 15N] entity, 20 mM sodium phosphate, 50 mM sodium chloride, 1 mM EDTA, 2 mM DTT, 93% H2O/7% D2O \| 93% H2O/7% D2O	Resolution not provided
3E9F Crystal structure short-form (residue1-113) of Eaf3 chromo domain Deposited 2008-08-22	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–113（113 aa） Fragment：Eaf3, UNP residues 1-113	Not recorded	MES 2-(N-MORPHOLINO)-ETHANESULFONIC ACID × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；277 K；30% polyethylene glycol 6000, 0.1M MES, pH 6.0, hanging drop, temperature 277K, VAPOR DIFFUSION, HANGING DROP	Resolution 1.80 Å R-free 0.217
3E9G Crystal structure long-form (residue1-124) of Eaf3 chromo domain Deposited 2008-08-22	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–124（124 aa） Fragment：Eaf3, UNP residues 1-124	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；277 K；2.4M ammonium sulfate, 4% acetone, 0.1 MBicine, pH 9.0, pH 6.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.50 Å R-free 0.267
3E9G Crystal structure long-form (residue1-124) of Eaf3 chromo domain Deposited 2008-08-22	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 1–124（124 aa） Fragment：Eaf3, UNP residues 1-124	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；277 K；2.4M ammonium sulfate, 4% acetone, 0.1 MBicine, pH 9.0, pH 6.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.50 Å R-free 0.267
6K5W Solution structure of the chromodomain of yeast Eaf3 Deposited 2019-05-31	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–120（120 aa）	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.8；298 K；Ionic strength (raw mmCIF value) 30；Pressure 1 NMR sample composition 1.47 mM [U-13C,15N] Eaf3, 90% H2O/10% D2O \| 90% H2O/10% D2O NMR sample composition 1.47 mM [U-13C,15N] Eaf3, 100% D2O \| 100% D2O NMR sample composition 1.47 mM [U-15N] Eaf3, 90% H2O/10% D2O \| 90% H2O/10% D2O	Resolution not provided
7YI0 Cryo-EM structure of Rpd3S complex Deposited 2022-07-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain C 1–401（401 aa） Chain E 1–401（401 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
7YI1 Cryo-EM structure of Eaf3 CHD bound to H3K36me3 nucleosome Deposited 2022-07-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 10 PDB declaration: dodecameric	Chain K 1–401（401 aa） Chain L 1–401（401 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
7YI3 Cryo-EM structure of Rpd3S in close-state Rpd3S-NCP complex Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 5 PDB declaration: pentameric	Chain C 1–401（401 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
7YI4 Cryo-EM structure of Rpd3S complex bound to H3K36me3 nucleosome in close state Deposited 2022-07-14	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain C 1–401（401 aa） Chain E 1–401（401 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.96 Å
7YI5 Cryo-EM structure of Rpd3S complex bound to H3K36me3 nucleosome in loose state Deposited 2022-07-14	Different construct Different mutation/modification Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain C 1–401（401 aa） Chain E 1–401（401 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.96 Å
8KC7 Rpd3S histone deacetylase complex Deposited 2023-08-06	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain D 1–401（401 aa） Chain F 1–401（401 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.46 Å
8KD2 Rpd3S in complex with 187bp nucleosome Deposited 2023-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain D 1–401（401 aa） Chain F 1–401（401 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.02 Å
8KD3 Rpd3S in complex with nucleosome with H3K36MLA modification, H3K9Q mutation and 187bp DNA Deposited 2023-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain D 1–401（401 aa） Chain F 1–401（401 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8KD4 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class1 Deposited 2023-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain D 1–401（401 aa） Chain F 1–401（401 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.93 Å
8KD5 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class2 Deposited 2023-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: 16-meric	Chain D 1–401（401 aa） Chain F 1–401（401 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8KD6 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class3 Deposited 2023-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain D 1–401（401 aa） Chain F 1–401（401 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.07 Å
8KD7 Rpd3S in complex with nucleosome with H3K36MLA modification and 167bp DNA Deposited 2023-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain D 1–401（401 aa） Chain F 1–401（401 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.09 Å
8TOF Rpd3S bound to an H3K36Cme3 modified nucleosome Deposited 2023-08-03	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 16 PDB declaration: octadecameric	Chain D 1–401（401 aa） Chain E 1–401（401 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
8W9C Cryo-EM structure of the Rpd3S complex from budding yeast Deposited 2023-09-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain C 1–401（401 aa） Chain D 1–401（401 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
8W9D Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 1 Deposited 2023-09-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 16 PDB declaration: 18-meric	Chain C 1–401（401 aa） Chain D 1–401（401 aa） Chain G 1–401（401 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å
8W9E Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 2 Deposited 2023-09-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 15 PDB declaration: 17-meric	Chain C 1–401（401 aa） Chain D 1–401（401 aa） Chain G 1–401（401 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.60 Å
8W9F Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 3 Deposited 2023-09-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 15 PDB declaration: 17-meric	Chain C 1–401（401 aa） Chain D 1–401（401 aa） Chain G 1–401（401 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.40 Å

22 other PDB entries and 23 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	EAF3_YEAST
Isoform	—
PDB entities	5
Chains and sequence ranges	Author chain C； PDBConstruct 1–401； UniProt 1–401

Transcriptional regulatory protein RCO1

Saccharomyces cerevisiae S288C

UniProt Q04779

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Heteromer Protein × 5 DNA 2 PDB declaration: heptameric（7） Consistent with all polymer counts	Chain D； UniProt 1–684 Chain E； UniProt 1–684	Not recorded	Wisdom 601 DNA (167-MER) × 1 Wisdom 601 DNA (167-MER) × 1 Transcriptional regulatory protein SIN3 × 1 （P22579） Histone deacetylase RPD3 × 1 （P32561） Chromatin modification-related protein EAF3 × 1 （Q12432） ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.40 Å

Other States of the Same Protein in the Database

Other PDB	Difference from Current Entry 7YI2	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
7YI0 Cryo-EM structure of Rpd3S complex Deposited 2022-07-14	Different mutation/modification Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain D 1–684（684 aa） Chain F 1–684（684 aa）	Mutation：F567A	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
7YI3 Cryo-EM structure of Rpd3S in close-state Rpd3S-NCP complex Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 5 PDB declaration: pentameric	Chain D 1–684（684 aa） Chain E 1–684（684 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
7YI4 Cryo-EM structure of Rpd3S complex bound to H3K36me3 nucleosome in close state Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain D 1–684（684 aa） Chain F 1–684（684 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.96 Å
7YI5 Cryo-EM structure of Rpd3S complex bound to H3K36me3 nucleosome in loose state Deposited 2022-07-14	Different oligomeric state Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain D 1–684（684 aa） Chain F 1–684（684 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.96 Å
8KC7 Rpd3S histone deacetylase complex Deposited 2023-08-06	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain E 1–684（684 aa） Chain G 1–684（684 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.46 Å
8KD2 Rpd3S in complex with 187bp nucleosome Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain E 1–684（684 aa） Chain G 1–684（684 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.02 Å
8KD3 Rpd3S in complex with nucleosome with H3K36MLA modification, H3K9Q mutation and 187bp DNA Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain E 1–684（684 aa） Chain G 1–684（684 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8KD4 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class1 Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain E 1–684（684 aa） Chain G 1–684（684 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.93 Å
8KD5 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class2 Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: 16-meric	Chain E 1–684（684 aa） Chain G 1–684（684 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å
8KD6 Rpd3S in complex with nucleosome with H3K36MLA modification and 187bp DNA, class3 Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain E 1–684（684 aa） Chain G 1–684（684 aa）	Not recorded	ZN ZINC ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.07 Å
8KD7 Rpd3S in complex with nucleosome with H3K36MLA modification and 167bp DNA Deposited 2023-08-09	Different oligomeric state Different ligand/ion Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 14 PDB declaration: hexadecameric	Chain E 1–684（684 aa） Chain G 1–684（684 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.09 Å
8TOF Rpd3S bound to an H3K36Cme3 modified nucleosome Deposited 2023-08-03	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 16 PDB declaration: octadecameric	Chain F 1–684（684 aa） Chain G 1–684（684 aa）	Not recorded	ZN ZINC ION × 5	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
8W9C Cryo-EM structure of the Rpd3S complex from budding yeast Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain E 1–684（684 aa） Chain F 1–684（684 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
8W9D Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 1 Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 16 PDB declaration: 18-meric	Chain E 1–684（684 aa） Chain F 1–684（684 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.90 Å
8W9E Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 2 Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 15 PDB declaration: 17-meric	Chain E 1–684（684 aa） Chain F 1–684（684 aa）	Not recorded	ZN ZINC ION × 7 K POTASSIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.60 Å
8W9F Cryo-EM structure of the Rpd3S-nucleosome complex from budding yeast in State 3 Deposited 2023-09-05	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 15 PDB declaration: 17-meric	Chain E 1–684（684 aa） Chain F 1–684（684 aa）	Not recorded	ZN ZINC ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 4.40 Å

16 other PDB entries and 16 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	RCO1_YEAST
Isoform	—
PDB entities	6
Chains and sequence ranges	Author chain D； PDBConstruct 1–684； UniProt 1–684 Author chain E； PDBConstruct 1–684； UniProt 1–684

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	7yi2
Deposition date deposition_date	2022-07-14
Structure title title	Cryo-EM structure of Rpd3S in loose-state Rpd3S-NCP complex
Keywords keywords	Dynamic Histone Modifications, Gene Regulation, Histone Deacetylase Complex; GENE REGULATION
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	39.55 Å
Radius of gyration Rg (electron density) rg_electron	39.17 Å
Forward intensity I(0) i0	479446000.00
Molecular weight molecular_weight	173290.0 kDa
Excluded volume excluded_volume	214380 Å³
Envelope volume envelope_volume	296240 Å³
Hydration-shell volume shell_volume	62111 Å³
Envelope diameter envelope_diameter	130.1 Å
Shell Rg shell_rg	45.76 Å
Envelope Rg envelope_rg	38.75 Å
Shape Rg shape_rg	39.15 Å
Total Rg total_rg	39.63 Å
Total atoms total_atoms	12140
Residues n_residues	1430
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	128.5 Å
Rg (real space) rg_real	39.37 Å
Rg uncertainty (real space) rg_real_error	0.97 Å
I(0) (real space) i0_real	4.7940e+08
I(0) uncertainty (real space) i0_real_error	7.7660e+06
Rg (reciprocal space) rg_reciprocal	39.49 Å
I(0) (reciprocal space) i0_reciprocal	479500000.0000
Solution quality estimate total_estimate	0.8937
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	51.4 Å
Skewness Skewness skewness	0.186
Kurtosis Kurtosis kurtosis	-0.466
Angular range angular_range	— – 0.2000 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	69700000.0000
Real-space data points n_real_points	41
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.900; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.998; Smooth: 0.916

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	Wisdom 601 DNA (167-MER)
Molecular weight formula_weight	51308.7 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G
Atom count atom_count	12140

CTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGCATGTATTGAACAGCGACC

来源 Source

来源生物 organism	synthetic construct
NCBI Class编号 ncbi_taxonomy_id	32630
宿主生物 host_organism	synthetic construct

Entity 2 Entity 2 polymer

Description description	Wisdom 601 DNA (167-MER)
Molecular weight formula_weight	51798.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	H

GGTCGCTGTTCAATACATGCACAGGATGTATATATCTGACACGTGCCTGGAGACTAGGGAGTAATCCCCTTGGCGGTTAAAACGCGGGGGACAGCGCGTACGTGCGTTTAAGCGGTGCTAGAGCTGTCTACGACCAATTGAGCGGCCTGCAGACCGGGATTCTCCAG

来源 Source

来源生物 organism	synthetic construct
NCBI Class编号 ncbi_taxonomy_id	32630
宿主生物 host_organism	synthetic construct

Entity 3 Entity 3 polymer

Description description	Transcriptional regulatory protein SIN3
Molecular weight formula_weight	175047.3 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

MSQVWHNSNSQSNDVATSNDATGSNERNEKEPSLQGNKPGFVQQQQRITLPSLSALSTKEEDRRDSNGQQALTSHAAHILGYPPPHSNAMPSIATDSALKQPHEYHPRPKSSSSSPSINASLMNAGPAPLPTVGAASFSLSRFDNPLPIKAPVHTEEPKSYNGLQEEEKATQRPQDCKEVPAGVQPADAPDPSSNHADANDDNNNNENSHDEDADYRPLNVKDALSYLEQVKFQFSSRPDIYNLFLDIMKDFKSQAIDTPGVIERVSTLFRGYPILIQGFNTFLPQGYRIECSSNPDDPIRVTTPMGTTTVNNNISPSGRGTTDAQELGSFPESDGNGVQQPSNVPMVPSSVYQSEQNQDQQQSLPLLATSSGLPSIQQPEMPAHRQIPQSQSLVPQEDAKKNVDVEFSQAISYVNKIKTRFADQPDIYKHFLEILQTYQREQKPINEVYAQVTHLFQNAPDLLEDFKKFLPDSSASANQQVQHAQQHAQQQHEAQMHAQAQAQAQAQAQVEQQKQQQQFLYPASGYYGHPSNRGIPQQNLPPIGSFSPPTNGSTVHEAYQDQQHMQPPHFMPLPSIVQHGPNMVHQGIANENPPLSDLRTSLTEQYAPSSIQHQQQHPQSISPIANTQYGDIPVRPEIDLDPSIVPVVPEPTEPIENNISLNEEVTFFEKAKRYIGNKHLYTEFLKILNLYSQDILDLDDLVEKVDFYLGSNKELFTWFKNFVGYQEKTKCIENIVHEKHRLDLDLCEAFGPSYKRLPKSDTFMPCSGRDDMCWEVLNDEWVGHPVWASEDSGFIAHRKNQYEETLFKIEEERHEYDFYIESNLRTIQCLETIVNKIENMTENEKANFKLPPGLGHTSMTIYKKVIRKVYDKERGFEIIDALHEHPAVTAPVVLKRLKQKDEEWRRAQREWNKVWRELEQKVFFKSLDHLGLTFKQADKKLLTTKQLISEISSIKVDQTNKKIHWLTPKPKSQLDFDFPDKNIFYDILCLADTFITHTTAYSNPDKERLKDLLKYFISLFFSISFEKIEESLYSHKQNVSESSGSDDGSSIASRKRPYQQEMSLLDILHRSRYQKLKRSNDEDGKVPQLSEPPEEEPNTIEEEELIDEEAKNPWLTGNLVEEANSQGIIQNRSIFNLFANTNIYIFFRHWTTIYERLLEIKQMNERVTKEINTRSTVTFAKDLDLLSSQLSEMGLDFVGEDAYKQVLRLSRRLINGDLEHQWFEESLRQAYNNKAFKLYTIDKVTQSLVKHAHTLMTDAKTAEIMALFVKDRNASTTSAKDQIIYRLQVRSHMSNTENMFRIEFDKRTLHVSIQYIALDDLTLKEPKADEDKWKYYVTSYALPHPTEGIPHEKLKIPFLERLIEFGQDIDGTEVDEEFSPEGISVSTLKIKIQPITYQLHIENGSYDVFTRKATNKYPTIANDNTQKGMVSQKKELISKFLDCAVGLRNNLDEAQKLSMQKKWENLKDSIAKTSAGNQGIESETEKGKITKQEQSDNLDSSTASVLPASITTVPQDDNIETTGNTESSDKGAKIQ

来源 Source

来源生物 organism	Saccharomyces cerevisiae S288C
通用名 common_name	;baker's yeast ;
NCBI Class编号 ncbi_taxonomy_id	559292
宿主生物 host_organism	Spodoptera frugiperda

Entity 4 Entity 4 polymer

Description description	Histone deacetylase RPD3
Molecular weight formula_weight	48962.0 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	B

MVYEATPFDPITVKPSDKRRVAYFYDADVGNYAYGAGHPMKPHRIRMAHSLIMNYGLYKKMEIYRAKPATKQEMCQFHTDEYIDFLSRVTPDNLEMFKRESVKFNVGDDCPVFDGLYEYCSISGGGSMEGAARLNRGKCDVAVNYAGGLHHAKKSEASGFCYLNDIVLGIIELLRYHPRVLYIDIDVHHGDGVEEAFYTTDRVMTCSFHKYGEFFPGTGELRDIGVGAGKNYAVNVPLRDGIDDATYRSVFEPVIKKIMEWYQPSAVVLQCGGDSLSGDRLGCFNLSMEGHANCVNYVKSFGIPMMVVGGGGYTMRNVARTWCFETGLLNNVVLDKDLPYNEYYEYYGPDYKLSVRPSNMFNVNTPEYLDKVMTNIFANLENTKYAPSVQLNHTPRDAEDLGDVEEDSAEAKDTKGGSQYARDLHVEHDNEFY

来源 Source

来源生物 organism	Saccharomyces cerevisiae S288C
通用名 common_name	;baker's yeast ;
NCBI Class编号 ncbi_taxonomy_id	559292
宿主生物 host_organism	Spodoptera frugiperda

Entity 5 Entity 5 polymer

Description description	Chromatin modification-related protein EAF3
Molecular weight formula_weight	45266.4 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C

MVDLEQEFALGGRCLAFHGPLMYEAKILKIWDPSSKMYTSIPNDKPGGSSQATKEIKPQKLGEDESIPEEIINGKCFFIHYQGWKSSWDEWVGYDRIRAYNEENIAMKKRLANEAKEAKKSLLEQQKKKKLSTSLGGPSNGGKRKGDSRSNASISKSTSQSFLTSSVSGRKSGRSSANSLHPGSSLRSSSDQNGNDDRRRSSSLSPNMLHHIAGYPTPKISLQIPIKLKSVLVDDWEYVTKDKKICRLPADVTVEMVLNKYEHEVSQELESPGSQSQLSEYCAGLKLYFDKCLGNMLLYRLERLQYDELLKKSSKDQKPLVPIRIYGAIHLLRLISVLPELISSTTMDLQSCQLLIKQTEDFLVWLLMHVDEYFNDKDPNRSDDALYVNTSSQYEGVALGM

来源 Source

来源生物 organism	Saccharomyces cerevisiae S288C
通用名 common_name	;baker's yeast ;
NCBI Class编号 ncbi_taxonomy_id	559292
宿主生物 host_organism	Spodoptera frugiperda

Entity 6 Entity 6 polymer

Description description	Transcriptional regulatory protein RCO1
Molecular weight formula_weight	78951.3 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	D,E

MDTSKKDTTRSPSHSNSSSPSSSSLSSSSSKEKKRPKRLSSQNVNYDLKRRKIITSEGIERSFKNEHSNLAVEDNIPEEEPKELLEKDSKGNIIKLNEPSTISEDSKVSVTGLPLNKGPSEKIKRESLWNYRKNLGGQSNNSEMTLVPSKRFTQVPKNFQDLNRNDLKTFLTENMTEESNIRSTIGWNGDIINRTRDREPESDRDNKKLSNIRTKIILSTNATYDSKSKLFGQNSIKSTSNASEKIFRDKNNSTIDFENEDFCSACNQSGSFLCCDTCPKSFHFLCLDPPIDPNNLPKGDWHCNECKFKIFINNSMATLKKIESNFIKQNNNVKIFAKLLFNIDSHNPKQFQLPNYIKETFPAVKTGSRGQYSDENDKIPLTDRQLFNTSYGQSITKLDSYNPDTHIDSNSGKFLICYKCNQTRLGSWSHPENSRLIMTCDYCQTPWHLDCVPRASFKNLGSKWKCPLHSPTKVYKKIHHCQEDNSVNYKVWKKQRLINKKNQLYYEPLQKIGYQNNGNIQIIPTTSHTDYDFNQDFKITQIDENSIKYDFFDKIYKSKMVQKRKLFQFQESLIDKLVSNGSQNGNSEDNMVKDIASLIYFQVSNNDKSSNNKSASKSNNLRKLWDLKELTNVVVPNELDSIQFNDFSSDEIKHLLYLKKIIESKPKEELLKFLNIENPENQSE

来源 Source

来源生物 organism	Saccharomyces cerevisiae S288C
通用名 common_name	;baker's yeast ;
NCBI Class编号 ncbi_taxonomy_id	559292
宿主生物 host_organism	Spodoptera frugiperda

Entity 7 Entity 7 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	5

▼

7. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

Domain ID domain_id	7yi2B01
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	800 — Arginase; Chain A
Homologous superfamily homologous superfamily	20 — Histone deacetylase domain

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.40 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	89653

fit	/app/data/saxs_computation/yi/7yi2/7yi2.fit
pddf	/app/data/pr_computation/yi/7yi2/7yi2.pr.out
profile	/app/data/saxs_computation/yi/7yi2/7yi2.dat

Cryo-EM structure of Rpd3S in loose-state Rpd3S-NCP complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Transcriptional regulatory protein SIN3

State in the Current Structure

Other States of the Same Protein in the Database

Histone deacetylase RPD3

State in the Current Structure

Other States of the Same Protein in the Database

Chromatin modification-related protein EAF3

State in the Current Structure

Other States of the Same Protein in the Database

Transcriptional regulatory protein RCO1

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 polymer

Polymer Polymer

来源 Source

Entity 4 Entity 4 polymer

Polymer Polymer

来源 Source

Entity 5 Entity 5 polymer

Polymer Polymer

来源 Source

Entity 6 Entity 6 polymer

Polymer Polymer

来源 Source

Entity 7 Entity 7 non-polymer

7. Fold Classification (SCOP + CATH) 1 domains

CATH v4.4 (1 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)