9b89

Cryo-EM structure of human ADAR1 in complex with dsRNA derived from HT2C gene in the pre-editing state

Method: ELECTRON MICROSCOPY D_max: 111.7 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Maltodextrin-binding protein,Double-stranded RNA-specific adenosine deaminase

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Insufficient information Homooligomer Protein × 2 RNA 1 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain A； UniProt 27–392 Chain B； UniProt 27–392	Not recorded	RNA (71-MER) × 1 IHP INOSITOL HEXAKISPHOSPHATE × 2 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.87 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 9B89	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
6USM Structure of nuclease domain of human parvovirus B19 non-structural protein 1 in complex with zinc Deposited 2019-10-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 27–392（366 aa）	Not recorded	ZN ZINC ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；293 K；1.2 M LiSo4 and sodium acetate tri-hydrate buffer of pH4.6	Resolution 3.37 Å
6WH0 Crystal structure of HyBcl-2-4 with HyBax BH3 Deposited 2020-04-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 27–392（366 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.5；293 K；0.2M Magnesium chloride hexahydrate, 0.1 Bis Tris pH 5.5, 25% PEG 3350	Resolution 1.99 Å R-free 0.268
7JHG Cryo-EM structure of ATP-bound fully inactive AMPK in complex with Dorsomorphin (Compound C) and Fab-nanobody Deposited 2020-07-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 7 PDB declaration: heptameric	Chain M 26–392（367 aa）	Not recorded	TAK 6-[4-(2-piperidin-1-ylethoxy)phenyl]-3-pyridin-4-ylpyrazolo[1,5-a]pyrimidine × 1 ATP ADENOSINE-5'-TRIPHOSPHATE × 1 ADP ADENOSINE-5'-DIPHOSPHATE × 1 AMP ADENOSINE MONOPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.47 Å
7JHH Cryo-EM structure of ATP-bound fully inactive AMPK in complex with Fab and nanobody Deposited 2020-07-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Heteromer；Protein × 7 PDB declaration: heptameric	Chain M 26–392（367 aa）	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1 ADP ADENOSINE-5'-DIPHOSPHATE × 1 AMP ADENOSINE MONOPHOSPHATE × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.92 Å
8DEI Structure of the Cac1 KER domain Deposited 2022-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain A 27–392（366 aa） Fragment：KER domain, residues 136-225	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；288 K；0.1 M Phosphate/citrate pH 4.2 and 30 % PEG 300	Resolution 2.81 Å R-free 0.282
8DEI Structure of the Cac1 KER domain Deposited 2022-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain B 27–392（366 aa） Fragment：KER domain, residues 136-225	Not recorded	PEG DI(HYDROXYETHYL)ETHER × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；288 K；0.1 M Phosphate/citrate pH 4.2 and 30 % PEG 300	Resolution 2.81 Å R-free 0.282
8DEI Structure of the Cac1 KER domain Deposited 2022-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain C 27–392（366 aa） Fragment：KER domain, residues 136-225	Not recorded	PEG DI(HYDROXYETHYL)ETHER × 2 PO4 PHOSPHATE ION × 1 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；288 K；0.1 M Phosphate/citrate pH 4.2 and 30 % PEG 300	Resolution 2.81 Å R-free 0.282
8DEI Structure of the Cac1 KER domain Deposited 2022-06-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain D 27–392（366 aa） Fragment：KER domain, residues 136-225	Not recorded	PEG DI(HYDROXYETHYL)ETHER × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；288 K；0.1 M Phosphate/citrate pH 4.2 and 30 % PEG 300	Resolution 2.81 Å R-free 0.282
8E0P Crystal structure of mouse APCDD1 in fusion with engineered MBP Deposited 2022-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain A 29–392（364 aa）	Mutation：D84A, K85A, E174A, N175A, A217H, K221H, K241A, A314V, I319V, E361A, K364A, D365A	NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 3 PLM PALMITIC ACID × 1 GOL GLYCEROL × 1 CL CHLORIDE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 7；293 K；0.2 M ammonium citrate, pH 7.0, 20% PEG3350, 4% NDSB-256, 5% glycerol	Resolution 2.33 Å R-free 0.239
8E0P Crystal structure of mouse APCDD1 in fusion with engineered MBP Deposited 2022-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain B 29–392（364 aa）	Mutation：D84A, K85A, E174A, N175A, A217H, K221H, K241A, A314V, I319V, E361A, K364A, D365A	NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 3 GOL GLYCEROL × 2 CL CHLORIDE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 7；293 K；0.2 M ammonium citrate, pH 7.0, 20% PEG3350, 4% NDSB-256, 5% glycerol	Resolution 2.33 Å R-free 0.239
8E0P Crystal structure of mouse APCDD1 in fusion with engineered MBP Deposited 2022-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain C 29–392（364 aa）	Mutation：D84A, K85A, E174A, N175A, A217H, K221H, K241A, A314V, I319V, E361A, K364A, D365A	NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 3 PLM PALMITIC ACID × 1 GOL GLYCEROL × 1 DMX 3-[BENZYL(DIMETHYL)AMMONIO]PROPANE-1-SULFONATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 7；293 K；0.2 M ammonium citrate, pH 7.0, 20% PEG3350, 4% NDSB-256, 5% glycerol	Resolution 2.33 Å R-free 0.239
8E0P Crystal structure of mouse APCDD1 in fusion with engineered MBP Deposited 2022-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Insufficient information Monomer；Protein × 1 PDB declaration: monomeric	Chain D 29–392（364 aa）	Mutation：D84A, K85A, E174A, N175A, A217H, K221H, K241A, A314V, I319V, E361A, K364A, D365A	NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 3 GOL GLYCEROL × 1 CL CHLORIDE ION × 1 DMX 3-[BENZYL(DIMETHYL)AMMONIO]PROPANE-1-SULFONATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 7；293 K；0.2 M ammonium citrate, pH 7.0, 20% PEG3350, 4% NDSB-256, 5% glycerol	Resolution 2.33 Å R-free 0.239
8IIY Crystal structure of MBP fused GAS41 YEATS domain in complex with H3K14ac peptide Deposited 2023-02-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 3 PDB declaration: trimeric	Chain A 27–392（366 aa）	Mutation：D108A, K109A, E198A, N199A, K265A	GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；100 mM Tris buffer (pH 8.5) containing 20% (w/v) PEG monomethyl ether 2000, 200 mM trimethylamine N-oxide	Resolution 2.15 Å R-free 0.247
8IIZ Crystal structure of MBP fused GAS41 YEATS domain in complex with H3K27ac peptide Deposited 2023-02-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 3 PDB declaration: trimeric	Chain A 27–392（366 aa）	Mutation：D108A, K109A, E198A, N199A, K265A	GOL GLYCEROL × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；293 K；100 mM Tris buffer (pH 8.5) containing 20% (w/v) PEG monomethyl ether 2000, 200 mM trimethylamine N-oxide	Resolution 2.10 Å R-free 0.301
8SQB The cryo-EM structure of the EcBAM/EspP(beta7-12) complex Deposited 2023-05-04	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 6 PDB declaration: hexameric	Chain F 26–392（367 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.80 Å
9B83 Cryo-EM structure of human ADAR1 in complex with dsRNA derived from human GLI1 gene Deposited 2024-03-28	Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: trimeric	Chain A 27–392（366 aa） Chain B 27–392（366 aa）	Not recorded	IHP INOSITOL HEXAKISPHOSPHATE × 2 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.01 Å
9B84 Cryo-EM structure of human ADAR1 in complex with dsRNA derived from HT2C gene Deposited 2024-03-28	Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: trimeric	Chain A 27–392（366 aa） Chain B 27–392（366 aa）	Not recorded	IHP INOSITOL HEXAKISPHOSPHATE × 2 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
9BDT Apolipoprotein B 100 bound to LDL receptor and legobody Deposited 2024-04-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 7 PDB declaration: heptameric	Chain B 27–384（358 aa）	Not recorded	NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 4 CA CALCIUM ION × 7	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 5.40 Å
9COO Nanobody 4 bound to Apolipoprotein B 100 Deposited 2024-07-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: hexameric	Chain B 27–384（358 aa）	Not recorded	NAG 2-acetamido-2-deoxy-beta-D-glucopyranose × 3 CA CALCIUM ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.73 Å
9IVP 24-mer DARPin-apoferritin scaffold in complex with the maltose binding protein Deposited 2024-07-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 48 PDB declaration: 48-meric	Chain AA 27–392（366 aa） Chain B 27–392（366 aa） Chain CA 27–392（366 aa） Chain D 27–392（366 aa） Chain EA 27–392（366 aa） Chain F 27–392（366 aa） Chain GA 27–392（366 aa） Chain H 27–392（366 aa） Chain IA 27–392（366 aa） Chain J 27–392（366 aa） Chain KA 27–392（366 aa） Chain L 27–392（366 aa） Chain MA 27–392（366 aa） Chain N 27–392（366 aa） Chain OA 27–392（366 aa） Chain P 27–392（366 aa） Chain QA 27–392（366 aa） Chain R 27–392（366 aa） Chain SA 27–392（366 aa） Chain T 27–392（366 aa） Chain UA 27–392（366 aa） Chain W 27–392（366 aa） Chain WA 27–392（366 aa） Chain Y 27–392（366 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
9ZVM Dimer structure of Thlaspi arvense plastid biotin carboxylase Deposited 2025-12-30	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 27–392（366 aa） Chain D 27–392（366 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8；50mM HEPES pH 8.0, 4mM MgCl2, 5% glycerol, 0.5mM TCEP cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.85 Å

15 other PDB entries and 21 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	C3SHQ8_ECOLX
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 2–367； UniProt 27–392 Author chain B； PDBConstruct 2–367； UniProt 27–392

Maltodextrin-binding protein,Double-stranded RNA-specific adenosine deaminase

Homo sapiens

UniProt P55265

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Insufficient information Homooligomer Protein × 2 RNA 1 PDB declaration: trimeric（3） Consistent with all polymer counts	Chain A； UniProt 127–1226 Chain B； UniProt 127–1226	Not recorded	RNA (71-MER) × 1 IHP INOSITOL HEXAKISPHOSPHATE × 2 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen ETHANE	Resolution 3.87 Å

Other States of the Same Protein in the Database

Other PDB	Difference from Current Entry 9B89	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1QBJ CRYSTAL STRUCTURE OF THE ZALPHA Z-DNA COMPLEX Deposited 1999-04-22	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 133–209（77 aa） Fragment：N-TERMINAL HELIX-TURN-HELIX DOMAIN ZALPHA Chain B 133–209（77 aa） Fragment：N-TERMINAL HELIX-TURN-HELIX DOMAIN ZALPHA	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；HANGING DROP VAPOR DIFFUSION OVER 1.6 M (NH4)2SO4, 10 % GLYCEROL AT 24 DEGREES CELSIUS, pH 5.6	Resolution 2.10 Å R-free 0.265
1QBJ CRYSTAL STRUCTURE OF THE ZALPHA Z-DNA COMPLEX Deposited 1999-04-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain C 133–209（77 aa） Fragment：N-TERMINAL HELIX-TURN-HELIX DOMAIN ZALPHA	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；HANGING DROP VAPOR DIFFUSION OVER 1.6 M (NH4)2SO4, 10 % GLYCEROL AT 24 DEGREES CELSIUS, pH 5.6	Resolution 2.10 Å R-free 0.265
1QGP NMR STRUCTURE OF THE Z-ALPHA DOMAIN OF ADAR1, 15 STRUCTURES Deposited 1999-05-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 125–201（77 aa） Fragment：Z-ALPHA DOMAIN	Mutation：C125S	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 5；298 K；Ionic strength (raw mmCIF value) 0.137 M NACL；Pressure 1 NMR sample composition NA-PHOSPHATE	Resolution not provided
1XMK The Crystal structure of the Zb domain from the RNA editing enzyme ADAR1 Deposited 2004-10-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 294–366（73 aa）	Not recorded	CD CADMIUM ION × 2 NI NICKEL (II) ION × 1 CL CHLORIDE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 9；312 K；PEG1000, Cadmium Chloride, Nickel Chloride, Tris, pH 9.0, VAPOR DIFFUSION, HANGING DROP, temperature 312K, pH 9.00	Resolution 0.97 Å R-free 0.183
2ACJ Crystal structure of the B/Z junction containing DNA bound to Z-DNA binding proteins Deposited 2005-07-19	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 140–202（63 aa） Fragment：Zalpha domain, ADAR1 Chain B 140–202（63 aa） Fragment：Zalpha domain, ADAR1 Chain C 140–202（63 aa） Fragment：Zalpha domain, ADAR1 Chain D 140–202（63 aa） Fragment：Zalpha domain, ADAR1	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4.6；295 K；22-23% MPD, 55-60mM sodium acetate, 15-16mM calsium chloride, pH 4.6, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 2.60 Å R-free 0.285
2GXB Crystal Structure of The Za Domain bound to Z-RNA Deposited 2006-05-08	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 140–202（63 aa） Fragment：Za Domain Chain B 140–202（63 aa） Fragment：Za Domain	Not recorded	NA SODIUM ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 3.6；292 K；40% PEG600, 100mM Sodium Acetate, pH 3.6, VAPOR DIFFUSION, HANGING DROP, temperature 292K	Resolution 2.25 Å R-free 0.244
2L54 Solution structure of the Zalpha domain mutant of ADAR1 (N43A,Y47A) Deposited 2010-10-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 136–198（63 aa） Fragment：DRADA 1 domain, UNP residues 136-198	Mutation：N43A, Y47A	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.8；298 K；Pressure ambient NMR sample composition 50 mM sodium phosphate-1, 50 mM sodium chloride-2, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
2MDR Solution structure of the third double-stranded RNA-binding domain (dsRBD3) of human adenosine-deaminase ADAR1 Deposited 2013-09-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 708–801（94 aa） Fragment：UNP residues 708-801	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 7；313 K；Ionic strength (raw mmCIF value) 120；Pressure ambient NMR sample composition 0.7-0.9 mM [U-99% 13C; U-99% 15N] dsRBD3, 20 mM sodium phosphate, 100 mM potassium chloride, 1 mM DTT, 90% H2O/10% D2O \| 90% H2O/10% D2O NMR sample composition 0.7-0.9 mM [U-99% 13C; U-99% 15N] dsRBD3, 20 mM sodium phosphate, 100 mM potassium chloride, 1 mM DTT, 100% D2O \| 100% D2O NMR sample composition 0.7-0.9 mM [U-99% 15N] dsRBD3, 20 mM sodium phosphate, 100 mM potassium chloride, 1 mM DTT, 90% H2O/10% D2O \| 90% H2O/10% D2O NMR sample composition 0.7-0.9 mM dsRBD3, 20 mM sodium phosphate, 100 mM potassium chloride, 1 mM DTT, 90% H2O/10% D2O \| 90% H2O/10% D2O	Resolution not provided
3F21 Crystal structure of Zalpha in complex with d(CACGTG) Deposited 2008-10-28	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 133–209（77 aa） Fragment：N-terminal zalpha Domain, UNP residues 133-209 Chain B 133–209（77 aa） Fragment：N-terminal zalpha Domain, UNP residues 133-209	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；295 K；2.2M (NH4)2SO4, 10% Glycerol, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 2.20 Å R-free 0.279
3F21 Crystal structure of Zalpha in complex with d(CACGTG) Deposited 2008-10-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain C 133–209（77 aa） Fragment：N-terminal zalpha Domain, UNP residues 133-209	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；295 K；2.2M (NH4)2SO4, 10% Glycerol, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 2.20 Å R-free 0.279
3F22 Crystal structure of Zalpha in complex with d(CGTACG) Deposited 2008-10-28	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 133–209（77 aa） Fragment：N-terminal zalpha Domain, UNP residues 133-209 Chain B 133–209（77 aa） Fragment：N-terminal zalpha Domain, UNP residues 133-209	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；295 K；2.2M (NH4)2SO4, 10% Glycerol, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 2.50 Å R-free 0.269
3F22 Crystal structure of Zalpha in complex with d(CGTACG) Deposited 2008-10-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain C 133–209（77 aa） Fragment：N-terminal zalpha Domain, UNP residues 133-209	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；295 K；2.2M (NH4)2SO4, 10% Glycerol, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 2.50 Å R-free 0.269
3F23 Crystal structure of Zalpha in complex with d(CGGCCG) Deposited 2008-10-28	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 133–209（77 aa） Fragment：N-terminal zalpha Domain, UNP residues 133-209 Chain B 133–209（77 aa） Fragment：N-terminal zalpha Domain, UNP residues 133-209	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；295 K；2.2M (NH4)2SO4, 10% Glycerol, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 2.70 Å R-free 0.264
3F23 Crystal structure of Zalpha in complex with d(CGGCCG) Deposited 2008-10-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain C 133–209（77 aa） Fragment：N-terminal zalpha Domain, UNP residues 133-209	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；295 K；2.2M (NH4)2SO4, 10% Glycerol, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 2.70 Å R-free 0.264
3IRQ Crystal structure of a Z-Z junction Deposited 2009-08-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 140–202（63 aa） Fragment：Zalpha domain Chain B 140–202（63 aa） Fragment：Zalpha domain Chain C 140–202（63 aa） Fragment：Zalpha domain Chain D 140–202（63 aa） Fragment：Zalpha domain	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；293 K；17% PEG 2000, 0.1 M Tris-HCl, 0.2 M ammonium acetate, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.80 Å R-free 0.271
3IRR Crystal Structure of a Z-Z junction (with HEPES intercalating) Deposited 2009-08-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 140–202（63 aa） Fragment：Zalpha domain Chain B 140–202（63 aa） Fragment：Zalpha domain Chain C 140–202（63 aa） Fragment：Zalpha domain Chain D 140–202（63 aa） Fragment：Zalpha domain	Not recorded	EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；293 K；16% PEG 2000 MME, 0.1 M HEPES, 0.2 M ammonium acetate, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.65 Å R-free 0.283
5ZU1 Crystal Structure of BZ junction in diverse sequence Deposited 2018-05-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 140–198（59 aa） Chain B 140–198（59 aa） Chain C 140–198（59 aa） Chain D 140–198（59 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions BATCH MODE；pH 4.5；296 K；25% 2-methyl-2,4-pentanediol (MPD), 100mM NaOAC, pH 4.5	Resolution 3.01 Å R-free 0.280
5ZUO Crystal Structure of BZ junction in diverse sequence Deposited 2018-05-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 140–202（63 aa） Chain B 140–202（63 aa） Chain C 140–202（63 aa） Chain D 140–202（63 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions BATCH MODE；pH 7.5；296 K；20% dioxane, with microseeding of small crystals	Resolution 2.90 Å R-free 0.301
5ZUP Crystal Structure of BZ junction in diverse sequence Deposited 2018-05-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 140–202（63 aa） Chain B 140–202（63 aa） Chain C 140–202（63 aa） Chain D 140–202（63 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions BATCH MODE；pH 7.5；296 K；25% ethylene glycol, with microseeding of small crystal	Resolution 2.90 Å R-free 0.282
7C0I Crystal structure of chimeric mutant of E3L in complex with Z-DNA Deposited 2020-05-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 169–184（16 aa） Chain A 192–193（2 aa） Chain A 195–195（1 aa） Chain B 169–184（16 aa） Chain B 192–193（2 aa） Chain B 195–195（1 aa）	Not recorded	SO4 SULFATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4；295 K；Sodium citrate pH 4.0, Ammonium sulfate, ethylene glycol	Resolution 2.40 Å R-free 0.227
7C0I Crystal structure of chimeric mutant of E3L in complex with Z-DNA Deposited 2020-05-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain C 169–184（16 aa） Chain C 192–193（2 aa） Chain C 195–195（1 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 4；295 K；Sodium citrate pH 4.0, Ammonium sulfate, ethylene glycol	Resolution 2.40 Å R-free 0.227
7C0J Crystal structure of chimeric mutant of GH5 in complex with Z-DNA Deposited 2020-05-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 169–178（10 aa） Chain A 192–192（1 aa） Chain A 195–195（1 aa） Chain B 169–178（10 aa） Chain B 192–192（1 aa） Chain B 195–195（1 aa）	Mutation：K41G,S42E,R43G,K53A,R95A Mutation：K41G,S42E,R43G,K53A,R95A Mutation：K41G,S42E,R43G,K53A,R95A Mutation：K41G,S42E,R43G,K53A,R95A Mutation：K41G,S42E,R43G,K53A,R95A Mutation：K41G,S42E,R43G,K53A,R95A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6；295 K；MES pH 6.0, PEG 4000, ethylene glycol	Resolution 2.75 Å R-free 0.248
7ZJ1 Crystal structure of ADAR1-dsRBD3 dimer Deposited 2022-04-08	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 716–797（82 aa） Chain B 716–797（82 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 4；293 K；100 mM sodium citrate pH 4.0, 20% (w/v) PEG 6000, and 1.0 M LiCl	Resolution 1.65 Å R-free 0.225
7ZLQ Crystal structure of ADAR1-dsRBD3 dimer in complex with dsRNA Deposited 2022-04-15	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 2 PDB declaration: hexameric	Chain A 716–797（82 aa） Chain B 716–797（82 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；293 K；50 mM sodium cacodylate, 5% (w/v) PEG 4000, 30 mM CaCl2, 230 mM KCl	Resolution 2.80 Å R-free 0.266
8GBC Homo sapiens Zalpha mutant - N173S Deposited 2023-02-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 140–202（63 aa）	Mutation：N173S	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.4；277 K；Ionic strength (raw mmCIF value) 100；Pressure 1 NMR sample composition 2 mM [U-13C; U-15N] protein, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
8GBD Homo sapiens Zalpha mutant - P193A Deposited 2023-02-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 140–202（63 aa）	Mutation：P193A	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6.4；277 K；Ionic strength (raw mmCIF value) 100；Pressure 1 NMR sample composition 2 mM [U-13C; U-15N] protein, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
9B83 Cryo-EM structure of human ADAR1 in complex with dsRNA derived from human GLI1 gene Deposited 2024-03-28	Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: trimeric	Chain A 127–1226（1100 aa） Chain B 127–1226（1100 aa）	Not recorded	IHP INOSITOL HEXAKISPHOSPHATE × 2 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.01 Å
9B84 Cryo-EM structure of human ADAR1 in complex with dsRNA derived from HT2C gene Deposited 2024-03-28	Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: trimeric	Chain A 127–1226（1100 aa） Chain B 127–1226（1100 aa）	Not recorded	IHP INOSITOL HEXAKISPHOSPHATE × 2 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å

23 other PDB entries and 28 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	DSRAD_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 393–1492； UniProt 127–1226 Author chain B； PDBConstruct 393–1492； UniProt 127–1226

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9b89
Deposition date deposition_date	2024-03-29
Structure title title	Cryo-EM structure of human ADAR1 in complex with dsRNA derived from HT2C gene in the pre-editing state
Keywords keywords	ADAR1-dsRNA complex, pre-editing state, HYDROLASE-RNA complex; HYDROLASE/RNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	34.61 Å
Radius of gyration Rg (electron density) rg_electron	33.61 Å
Forward intensity I(0) i0	198957000.00
Molecular weight molecular_weight	102830.0 kDa
Excluded volume excluded_volume	124540 Å³
Envelope volume envelope_volume	168600 Å³
Hydration-shell volume shell_volume	42762 Å³
Envelope diameter envelope_diameter	111.0 Å
Shell Rg shell_rg	39.30 Å
Envelope Rg envelope_rg	33.40 Å
Shape Rg shape_rg	33.61 Å
Total Rg total_rg	34.03 Å
Total atoms total_atoms	7148
Residues n_residues	852
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	111.7 Å
Rg (real space) rg_real	34.56 Å
Rg uncertainty (real space) rg_real_error	1.11 Å
I(0) (real space) i0_real	1.9900e+08
I(0) uncertainty (real space) i0_real_error	3.4070e+06
Rg (reciprocal space) rg_reciprocal	34.60 Å
I(0) (reciprocal space) i0_reciprocal	199000000.0000
Solution quality estimate total_estimate	0.8318
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	36.4 Å
Skewness Skewness skewness	0.198
Kurtosis Kurtosis kurtosis	-0.652
Angular range angular_range	— – 0.2300 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	20150000.0000
Real-space data points n_real_points	47
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.938; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.996; Smooth: 0.000

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	Maltodextrin-binding protein,Double-stranded RNA-specific adenosine deaminase
Molecular weight formula_weight	165251.2 kDa
EC 编号 ec_number	3.5.4.37
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B
Atom count atom_count	7148

MKIEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELAKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTNSSSNNNNNNNNNNLGLEVLFQGPVSSHFQELSIYQDQEQRILKFLEELGEGKATTAHDLSGKLGTPKKEINRVLYSLAKKGKLQKEAGTPPLWKIAVSTQAWNQHSGVVRPDGHSQGAPNSDPSLEPEDRNSTSVSEDLLEPFIAVSAQAWNQHSGVVRPDSHSQGSPNSDPGLEPEDSNSTSALEDPLEFLDMAEIKEKICDYLFNVSDSSALNLAKNIGLTKARDINAVLIDMERQGDVYRQGTTPPIWHLTDKKRERMQIKRNTNSVPETAPAAIPETKRNAEFLTCNIPTSNASNNMVTTEKVENGQEPVIKLENRQEARPEPARLKPPVHYNGPSKAGYVDFENGQWATDDIPDDLNSIRAAPGEFRAIMEMPSFYSHGLPRCSPYKKLTECQLKNPISGLLEYAQFASQTCEFNMIEQSGPPHEPRFKFQVVINGREFPPAEAGSKKVAKQDAAMKAMTILLEEAKAKDSGKSEESSHYSTEKESEKTAESQTPTPSATSFFSGKSPVTTLLECMHKLGNSCEFRLLSKEGPAHEPKFQYCVAVGAQTFPSVSAPSKKVAKQMAAEEAMKALHGEATNSMASDNQPEGMISESLDNLESMMPNKVRKIGELVRYLNTNPVGGLLEYARSHGFAAEFKLVDQSGPPHEPKFVYQAKVGGRWFPAVCAHSKKQGKQEAADAALRVLIGENEKAERMGFTEVTPVTGASLRRTMLLLSRSPEAQPKTLPLTGSTFHDQIAMLSHRCFNTLTNSFQPSLLGRKILAAIIMKKDSEDMGVVVSLGTGNRCVKGDSLSLKGETVNDCHAEIISRRGFIRFLYSELMKYNSQTAKDSIFEPAKGGEKLQIKKTVSFHLYISTAPCGDGALFDKSCSDRAMESTESRHYPVFENPKQGKLRTKVENGEGTIPVESSDIVPTWDGIRLGERLRTMSCSDKILRWNVLGLQGALLTHFLQPIYLKSVTLGYLFSQGHLTRAICCRVTRDGSAFEDGLRHPFIVNHPKVGRVSIYDSKRQSGKTKETSVNWCLADGYDLEILDGTRGTVDGPRNELSRVSKKNIFLLFKKLCSFRYRRDLLRLSYGEAKKAARDYETAKNYFKKGLKDMGYGNWISKPQEEKNFYLCPV

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Homo sapiens

Entity 2 Entity 2 polymer

Description description	RNA (71-MER)
Molecular weight formula_weight	22682.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	C

GGGCUXUUCGUUUUCCUAUUGAGCAUAGCCGCUUCUUCGGCUAUGCUCAAUACUAUAGGAAAAUGAACAGU

Entity 3 Entity 3 non-polymer

Description description	INOSITOL HEXAKISPHOSPHATE
Molecular weight formula_weight	660.0 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.87 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	17410

fit	/app/data/saxs_computation/b8/9b89/9b89.fit
pddf	/app/data/pr_computation/b8/9b89/9b89.pr.out
profile	/app/data/saxs_computation/b8/9b89/9b89.dat

Cryo-EM structure of human ADAR1 in complex with dsRNA derived from HT2C gene in the pre-editing state

1. Protein Identity and Related Structures Protein Identity & Related Structures

Maltodextrin-binding protein,Double-stranded RNA-specific adenosine deaminase

State in the Current Structure

Other States of the Same Protein in the Database

Maltodextrin-binding protein,Double-stranded RNA-specific adenosine deaminase

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 non-polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)