SAXSdb — 2pi4

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

Enterobacteria phage T7

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Monomer	Protein 1 DNA 2	5'-D(CPTPTPCPCPTPAPTPAPGPTPGPAPGPTPCPGPTPAPTPTPA)-3' × 1 5'-D(TPAPAPTPAPCPGPAPCPTPCPAPCPT)-3' × 1 MAGNESIUM ION × 2 3'-DEOXY-GUANOSINE-5'-TRIPHOSPHATE × 2 water × 3	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	RPOL_BPT7
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain A； PDBConstruct 1–878； UniProt 6–883

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	2pi4
Deposition date deposition_date	2007-04-12
Structure title title	T7RNAP complexed with a phi10 protein and initiating GTPs.
Keywords keywords	T7 RNA polymerase, initiating nucleotides., Transferase-DNA COMPLEX; Transferase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

2pi4__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

2pi4__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

2pi4__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	30.90 Å
Rg (electron density)	29.85 Å
Total Rg	30.60 Å
Atom count	7593
Residues	898
Excluded volume	132870 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`2pi4__assembly_1__model_1`	trimeric （3）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	5'-D(CPTPTPCPCPTPAPTPAPGPTPGPAPGPTPCPGPTPAPTPTPA)-3'
Molecular weight formula_weight	6732.4 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	T
Atom count atom_count	7722

CTTCCTATAGTGAGTCGTATTA

Entity 2 Entity 2 polymer

Description description	5'-D(TPAPAPTPAPCPGPAPCPTPCPAPCPT)-3'
Molecular weight formula_weight	4223.8 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	P

TAATACGACTCACT

Entity 3 Entity 3 polymer

Description description	DNA-directed RNA polymerase
Molecular weight formula_weight	98410.6 kDa
EC 编号 ec_number	2.7.7.6
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

IAKNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFERQLKAGEVADNAAAKPLITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNVEEQLNKRVGHVYKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSETIELAPEYAEAIATRAGALAGISPMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKPEDIDMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVTDENTGEISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA

Source Source

Source organism organism	Enterobacteria phage T7
NCBI taxonomy ID ncbi_taxonomy_id	10760
Host organism host_organism	Escherichia coli

Entity 4 Entity 4 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 5 Entity 5 non-polymer

Description description	3'-DEOXY-GUANOSINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	507.2 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	129

▼

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (1 domains)

Domain ID domain_id	d2pi4a_
Class class	e — Multi-domain proteins (alpha and beta)
Fold Fold fold	e.8 — DNA/RNA polymerases
Superfamily Superfamily superfamily	e.8.1 — DNA/RNA polymerases
Family Family family	e.8.1.3 — T7 RNA polymerase

CATH v4.4 (5 domains)

Domain ID domain_id	2pi4A01
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	1320 — T7 RNA polymerase; domain 1
Homologous superfamily homologous superfamily	10 — DNA-directed RNA polymerase, N-terminal domain

Domain ID domain_id	2pi4A02
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	260 —

Domain ID domain_id	2pi4A03
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	70 — Alpha-Beta Plaits
Homologous superfamily homologous superfamily	370 —

Domain ID domain_id	2pi4A04
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	287 — Helix Hairpins
Homologous superfamily homologous superfamily	280 —

Domain ID domain_id	2pi4A05
Class class	1 — Mainly Alpha
Architecture architecture	10 — Orthogonal Bundle
Topology topology	150 — DNA polymerase; domain 1
Homologous superfamily homologous superfamily	20 — 5' to 3' exonuclease, C-terminal subdomain

▶

Unit-cell length a length_a	224.450 Å
Unit-cell length b length_b	73.791 Å
Unit-cell length c length_c	80.315 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	4

Space group space_group	P 21 21 2
Space-group number int_tables_number	18
Crystal system crystal_system	—

Resolution resolution	2.500 Å
Low-resolution limit resolution_low	39.040 Å
R factor r_factor	0.2650
R_work r_work	0.2650
R_free r_free	0.2970

T7RNAP complexed with a phi10 protein and initiating GTPs.

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2pi4__assembly_1__model_1

2pi4__assembly_1__model_1 | I(q)

2pi4__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (1 domains)

CATH v4.4 (5 domains)

7. Citations (1)

T7RNAP complexed with a phi10 protein and initiating GTPs.

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

2pi4__assembly_1__model_1

2pi4__assembly_1__model_1 | I(q)

2pi4__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Source Source

Entity 4 Entity 4 non-polymer

Entity 5 Entity 5 non-polymer

Entity 6 Entity 6 water

6. Fold Classification (SCOP + CATH) 6 domains

SCOP 2.08 (1 domains)

CATH v4.4 (5 domains)

7. Citations (1)