3e3j

Crystal Structure of an Intermediate Complex of T7 RNAP and 8nt of RNA

Method: X-RAY DIFFRACTION D_max: 156.3 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

Bacteriophage T7

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Other combination Monomer Protein × 1 DNA 2 RNA 1 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain B； UniProt 1–883	Mutation：P266L	DNA (28-MER) × 1 ;DNA (5'-D(DTPDAPDAPDTPDAPDCPDGPDAPDCPDTPDCPDAPDCPDTPDAPDTPDAPDTPDTPDTPDCPDTPDGPDCPDCPDAPDAPDAPDCPDGPDGPDC)-3') ; × 1 ;RNA (5'-R(GPGPGPAPGPUPAPA)-3') ; × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；pH 8.5；285 K；PEG 6000, MgCl2, Tris ph8.5 at 285K, VAPOR DIFFUSION, SITTING DROP	Resolution 6.70 Å R-free 0.454
2	Other combination Monomer Protein × 1 DNA 2 RNA 1 PDB declaration: tetrameric（4） Consistent with all polymer counts	Chain C； UniProt 1–883	Mutation：P266L	DNA (28-MER) × 1 ;DNA (5'-D(DTPDAPDAPDTPDAPDCPDGPDAPDCPDTPDCPDAPDCPDTPDAPDTPDAPDTPDTPDTPDCPDTPDGPDCPDCPDAPDAPDAPDCPDGPDGPDC)-3') ; × 1 ;RNA (5'-R(GPGPGPAPGPUPAPA)-3') ; × 1	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, SITTING DROP；pH 8.5；285 K；PEG 6000, MgCl2, Tris ph8.5 at 285K, VAPOR DIFFUSION, SITTING DROP	Resolution 6.70 Å R-free 0.454

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 3E3J	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1ARO T7 RNA POLYMERASE COMPLEXED WITH T7 LYSOZYME Deposited 1997-08-08	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain P 1–883（883 aa）	Mutation：C347S, C723S, C839S	HG MERCURY (II) ION × 7	X-RAY DIFFRACTION X-ray crystallization conditions pH 7；pH 7.0	Resolution 2.80 Å R-free 0.309
1CEZ CRYSTAL STRUCTURE OF A T7 RNA POLYMERASE-T7 PROMOTER COMPLEX Deposited 1999-03-11	Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.7；pH 8.7	Resolution 2.40 Å R-free 0.270
1H38 Structure of a T7 RNA polymerase elongation complex at 2.9A resolution Deposited 2002-08-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.1；10% PEG 8000, 8% GLYCEROL, 5MM BETA-MERCAPTOETHANOL,100 MM TRIS BUFFER, PH8.1, pH 8.10	Resolution 2.90 Å R-free 0.284
1H38 Structure of a T7 RNA polymerase elongation complex at 2.9A resolution Deposited 2002-08-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.1；10% PEG 8000, 8% GLYCEROL, 5MM BETA-MERCAPTOETHANOL,100 MM TRIS BUFFER, PH8.1, pH 8.10	Resolution 2.90 Å R-free 0.284
1H38 Structure of a T7 RNA polymerase elongation complex at 2.9A resolution Deposited 2002-08-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 3 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain C 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.1；10% PEG 8000, 8% GLYCEROL, 5MM BETA-MERCAPTOETHANOL,100 MM TRIS BUFFER, PH8.1, pH 8.10	Resolution 2.90 Å R-free 0.284
1H38 Structure of a T7 RNA polymerase elongation complex at 2.9A resolution Deposited 2002-08-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 4 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain D 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 8.1；10% PEG 8000, 8% GLYCEROL, 5MM BETA-MERCAPTOETHANOL,100 MM TRIS BUFFER, PH8.1, pH 8.10	Resolution 2.90 Å R-free 0.284
1MSW Structural basis for the transition from initiation to elongation transcription in T7 RNA polymerase Deposited 2002-09-19	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain D 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；294 K；PEG 8000, LiSO4, Mg(OAc)2, Tris-HCL, pH 7.0, VAPOR DIFFUSION, HANGING DROP at 294K	Resolution 2.10 Å R-free 0.275
1S0V Structural basis for substrate selection by T7 RNA polymerase Deposited 2004-01-05	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–882（882 aa）	Not recorded	MG MAGNESIUM ION × 2 APC DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 3.20 Å R-free 0.307
1S0V Structural basis for substrate selection by T7 RNA polymerase Deposited 2004-01-05	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–882（882 aa）	Not recorded	MG MAGNESIUM ION × 2 APC DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 3.20 Å R-free 0.307
1S0V Structural basis for substrate selection by T7 RNA polymerase Deposited 2004-01-05	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain C 1–882（882 aa）	Not recorded	MG MAGNESIUM ION × 2 APC DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 3.20 Å R-free 0.307
1S0V Structural basis for substrate selection by T7 RNA polymerase Deposited 2004-01-05	Different construct Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain D 1–882（882 aa）	Not recorded	MG MAGNESIUM ION × 2 APC DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER × 1	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 3.20 Å R-free 0.307
1S76 T7 RNA polymerase alpha beta methylene ATP elongation complex Deposited 2004-01-29	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain D 1–883（883 aa）	Not recorded	APC DIPHOSPHOMETHYLPHOSPHONIC ACID ADENOSYL ESTER × 1 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；298 K；T7 RNAP, DNA, RNA, alpha-beta methylene ATP, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.88 Å R-free 0.290
1S77 T7 RNAP product pyrophosphate elongation complex Deposited 2004-01-29	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain D 1–883（883 aa）	Not recorded	MG MAGNESIUM ION × 2 POP PYROPHOSPHATE 2- × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.2；298 K；T7RNAP, DNA,RNA, 3'deoxyATP, pH 7.2, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.69 Å R-free 0.285
2PI4 T7RNAP complexed with a phi10 protein and initiating GTPs. Deposited 2007-04-12	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 6–883（878 aa）	Not recorded	MG MAGNESIUM ION × 2 GH3 3'-DEOXY-GUANOSINE-5'-TRIPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；300 K；50 mM Tris-HCl, 200 mM Li2SO4, 20% PEG 8000, 5% Glycerol, 15 mM magnesium acetate, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 300K	Resolution 2.50 Å R-free 0.297
2PI5 T7 RNA polymerase complexed with a phi10 promoter Deposited 2007-04-12	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 6–883（878 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；300 K；50 mM Tris-HCl, 200 mM Li2SO4, 20% PEG 8000, 5% Glycerol, 15 mM magnesium acetate, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 300K	Resolution 2.90 Å R-free 0.268
3E2E Crystal Structure of an Intermediate Complex of T7 RNAP and 7nt of RNA Deposited 2008-08-05	Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain A 1–883（883 aa）	Mutation：P266L	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；285 K；PEG 6000, MgCl2, Tris ph8.0 at 285K, VAPOR DIFFUSION, SITTING DROP	Resolution 3.00 Å R-free 0.292
4RNP BACTERIOPHAGE T7 RNA POLYMERASE, HIGH SALT CRYSTAL FORM, LOW TEMPERATURE DATA, ALPHA-CARBONS ONLY Deposited 1997-09-11	Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 3.00 Å
4RNP BACTERIOPHAGE T7 RNA POLYMERASE, HIGH SALT CRYSTAL FORM, LOW TEMPERATURE DATA, ALPHA-CARBONS ONLY Deposited 1997-09-11	Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 3.00 Å
4RNP BACTERIOPHAGE T7 RNA POLYMERASE, HIGH SALT CRYSTAL FORM, LOW TEMPERATURE DATA, ALPHA-CARBONS ONLY Deposited 1997-09-11	Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION mmCIF provides none of the parsed conditions	Resolution 3.00 Å
8DH0 T7 RNA polymerase elongation complex with unnatural base dDs Deposited 2022-06-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Homooligomer；Protein × 4 PDB declaration: tetradecameric	Chain B 1–883（883 aa） Chain F 1–883（883 aa） Chain J 1–883（883 aa） Chain N 1–883（883 aa）	Not recorded	GOL GLYCEROL × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.90 Å R-free 0.261
8DH1 T7 RNA polymerase elongation complex with unnatural base dDs-PaTP pair Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–883（883 aa）	Not recorded	GOL GLYCEROL × 2 S8L 1-{5-O-[(S)-hydroxy{[(R)-hydroxy(phosphonooxy)phosphoryl]oxy}phosphoryl]-beta-D-ribofuranosyl}-1H-pyrrole-2-carbaldehyde × 1 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.65 Å R-free 0.272
8DH1 T7 RNA polymerase elongation complex with unnatural base dDs-PaTP pair Deposited 2022-06-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain E 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.65 Å R-free 0.272
8DH1 T7 RNA polymerase elongation complex with unnatural base dDs-PaTP pair Deposited 2022-06-24	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain I 1–883（883 aa）	Not recorded	GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.65 Å R-free 0.272
8DH1 T7 RNA polymerase elongation complex with unnatural base dDs-PaTP pair Deposited 2022-06-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 4 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain L 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.65 Å R-free 0.272
8DH2 T7 RNA polymerase elongation complex with unnatural base dDs-ATP mismatch Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–883（883 aa）	Not recorded	GOL GLYCEROL × 2 3PO TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.90 Å R-free 0.307
8DH2 T7 RNA polymerase elongation complex with unnatural base dDs-ATP mismatch Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain E 1–883（883 aa）	Not recorded	3PO TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.90 Å R-free 0.307
8DH2 T7 RNA polymerase elongation complex with unnatural base dDs-ATP mismatch Deposited 2022-06-24	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Other combination Monomer；Protein × 1 PDB declaration: trimeric	Chain I 1–883（883 aa）	Not recorded	GOL GLYCEROL × 1 3PO TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.90 Å R-free 0.307
8DH2 T7 RNA polymerase elongation complex with unnatural base dDs-ATP mismatch Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain L 1–883（883 aa）	Not recorded	3PO TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.90 Å R-free 0.307
8DH3 T7 RNA polymerase elongation complex with unnatural base dPa Deposited 2022-06-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 3.00 Å R-free 0.276
8DH3 T7 RNA polymerase elongation complex with unnatural base dPa Deposited 2022-06-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain E 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 3.00 Å R-free 0.276
8DH3 T7 RNA polymerase elongation complex with unnatural base dPa Deposited 2022-06-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 3 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain I 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 3.00 Å R-free 0.276
8DH3 T7 RNA polymerase elongation complex with unnatural base dPa Deposited 2022-06-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 4 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain M 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 3.00 Å R-free 0.276
8DH4 T7 RNA polymerase elongation complex with unnatural base dPa-DsTP pair Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–883（883 aa）	Not recorded	S96 (7P)-3-{5-O-[(R)-hydroxy{[(S)-hydroxy(phosphonooxy)phosphoryl]oxy}phosphoryl]-beta-D-ribofuranosyl}-7-(thiophen-2-yl)-3H-imidazo[4,5-b]pyridine × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.80 Å R-free 0.275
8DH4 T7 RNA polymerase elongation complex with unnatural base dPa-DsTP pair Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain E 1–883（883 aa）	Not recorded	S96 (7P)-3-{5-O-[(R)-hydroxy{[(S)-hydroxy(phosphonooxy)phosphoryl]oxy}phosphoryl]-beta-D-ribofuranosyl}-7-(thiophen-2-yl)-3H-imidazo[4,5-b]pyridine × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.80 Å R-free 0.275
8DH4 T7 RNA polymerase elongation complex with unnatural base dPa-DsTP pair Deposited 2022-06-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 3 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain I 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.80 Å R-free 0.275
8DH4 T7 RNA polymerase elongation complex with unnatural base dPa-DsTP pair Deposited 2022-06-24	Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 4 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain M 1–883（883 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.80 Å R-free 0.275
8DH5 T7 RNA polymerase elongation complex with unnatural base dPa-ATP mismatch Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain B 1–883（883 aa）	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.85 Å R-free 0.267
8DH5 T7 RNA polymerase elongation complex with unnatural base dPa-ATP mismatch Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain E 1–883（883 aa）	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.85 Å R-free 0.267
8DH5 T7 RNA polymerase elongation complex with unnatural base dPa-ATP mismatch Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain I 1–883（883 aa）	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.85 Å R-free 0.267
8DH5 T7 RNA polymerase elongation complex with unnatural base dPa-ATP mismatch Deposited 2022-06-24	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 4 Other combination Monomer；Protein × 1 PDB declaration: tetrameric	Chain M 1–883（883 aa）	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；298 K；10% PEG 8000, 8% glycerol, 5 mM B-mercaptoethanol, 100 mM Tris pH 8.1	Resolution 2.85 Å R-free 0.267
9YXM 10-23 DNAzyme in complex with T7 RNA Polymerase Deposited 2025-10-27	Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–883（883 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 4.62 Å

18 other PDB entries and 41 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	RPOL_BPT7
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain B； PDBConstruct 7–889； UniProt 1–883 Author chain C； PDBConstruct 7–889； UniProt 1–883

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	3e3j
Deposition date deposition_date	2008-08-07
Structure title title	Crystal Structure of an Intermediate Complex of T7 RNAP and 8nt of RNA
Keywords keywords	T7 RNA Polymerase, DNA-directed RNA Polymerase, Transcription, Nucleotidyltransferase, Transferase, Transferase-RNA-DNA COMPLEX; Transferase/RNA/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	47.07 Å
Radius of gyration Rg (electron density) rg_electron	46.61 Å
Forward intensity I(0) i0	856249000.00
Molecular weight molecular_weight	221150.0 kDa
Excluded volume excluded_volume	267760 Å³
Envelope volume envelope_volume	402550 Å³
Hydration-shell volume shell_volume	72394 Å³
Envelope diameter envelope_diameter	155.0 Å
Shell Rg shell_rg	51.29 Å
Envelope Rg envelope_rg	45.11 Å
Shape Rg shape_rg	46.59 Å
Total Rg total_rg	46.84 Å
Total atoms total_atoms	15403
Residues n_residues	1775
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	156.3 Å
Rg (real space) rg_real	47.12 Å
Rg uncertainty (real space) rg_real_error	1.39 Å
I(0) (real space) i0_real	8.5630e+08
I(0) uncertainty (real space) i0_real_error	1.6650e+07
Rg (reciprocal space) rg_reciprocal	47.07 Å
I(0) (reciprocal space) i0_reciprocal	856200000.0000
Solution quality estimate total_estimate	0.8210
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	47.4 Å
Skewness Skewness skewness	0.284
Kurtosis Kurtosis kurtosis	-0.657
Angular range angular_range	— – 0.1650 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	85270000.0000
Real-space data points n_real_points	34
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.891; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.994; Smooth: 0.000

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	DNA-directed RNA polymerase
Molecular weight formula_weight	99829.2 kDa
EC 编号 ec_number	2.7.7.6
Mutation mutation	P266L
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	C,B
Atom count atom_count	15406

HHHHHHMNTINIAKNDFSDIELAAIPFNTLADHYGERLAREQLALEHESYEMGEARFRKMFERQLKAGEVADNAAAKPLITTLLPKMIARINDWFEEVKAKRGKRPTAFQFLQEIKPEAVAYITIKTTLACLTSADNTTVQAVASAIGRAIEDEARFGRIRDLEAKHFKKNVEEQLNKRVGHVYKKAFMQVVEADMLSKGLLGGEAWSSWHKEDSIHVGVRCIEMLIESTGMVSLHRQNAGVVGQDSETIELAPEYAEAIATRAGALAGISLMFQPCVVPPKPWTGITGGGYWANGRRPLALVRTHSKKALMRYEDVYMPEVYKAINIAQNTAWKINKKVLAVANVITKWKHCPVEDIPAIEREELPMKPEDIDMNPEALTAWKRAAAAVYRKDKARKSRRISLEFMLEQANKFANHKAIWFPYNMDWRGRVYAVSMFNPQGNDMTKGLLTLAKGKPIGKEGYYWLKIHGANCAGVDKVPFPERIKFIEENHENIMACAKSPLENTWWAEQDSPFCFLAFCFEYAGVQHHGLSYNCSLPLAFDGSCSGIQHFSAMLRDEVGGRAVNLLPSETVQDIYGIVAKKVNEILQADAINGTDNEVVTVTDENTGEISEKVKLGTKALAGQWLAYGVTRSVTKRSVMTLAYGSKEFGFRQQVLEDTIQPAIDSGKGLMFTQPNQAAGYMAKLIWESVSVTVVAAVEAMNWLKSAAKLLAAEVKDKKTGEILRKRCAVHWVTPDGFPVWQEYKKPIQTRLNLMFLGQFRLQPTINTNKDSEIDAHKQESGIAPNFVHSQDGSHLRKTVVWAHEKYGIESFALIHDSFGTIPADAANLFKAVRETMVDTYESCDVLADFYDQFADQLHESQLDKMPALPAKGNLNLRDILESDFAFA

来源 Source

来源生物 organism	Bacteriophage T7
NCBI Class编号 ncbi_taxonomy_id	10760
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	DNA (28-MER)
Molecular weight formula_weight	9788.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	T,X

GCCGTTTTTACTCCCTATAGTGAGTCGTATTA

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(DTPDAPDAPDTPDAPDCPDGPDAPDCPDTPDCPDAPDCPDTPDAPDTPDAPDTPDTPDTPDCPDTPDGPDCPDCPDAPDAPDAPDCPDGPDGPDC)-3') ;
Molecular weight formula_weight	9744.3 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	N,Y

TAATACGACTCACTATATTTCTGCCAAACGGC

Entity 4 Entity 4 polymer

Description description	;RNA (5'-R(GPGPGPAPGPUPAPA)-3') ;
Molecular weight formula_weight	2629.6 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R,Z

GGGAGUAA

▶

8. Citations (1)

▶

Unit-cell length a length_a	99.216 Å
Unit-cell length b length_b	180.602 Å
Unit-cell length c length_c	198.619 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	8

Space group space_group	P 21 21 21
Space-group number int_tables_number	19
Crystal system crystal_system	—

Resolution resolution	6.700 Å
Low-resolution limit resolution_low	49.810 Å
R factor r_factor	0.3949
R_work r_work	0.3922
R_free r_free	0.4542

fit	/app/data/saxs_computation/e3/3e3j/3e3j.fit
pddf	/app/data/pr_computation/e3/3e3j/3e3j.pr.out
profile	/app/data/saxs_computation/e3/3e3j/3e3j.dat

Crystal Structure of an Intermediate Complex of T7 RNAP and 8nt of RNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-directed RNA polymerase

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)