SAXSdb — 1a02

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

NUCLEAR FACTOR OF ACTIVATED T CELLS

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Heteromer Protein × 3 DNA 2 PDB declaration: pentameric（5） Consistent with all polymer counts	Chain N； UniProt 396–678	Not recorded	;DNA (5'-D(DTPDTPDGPDGPDAPDAPDAPDAPDTPDTPDTPDGPDTPDTPDTPDCPDAPDTPDAPDG)-3') ; × 1 ;DNA (5'-D(DAPDAPDCPDTPDAPDTPDGPDAPDAPDAPDCPDAPDAPDAPDTPDTPDTPDTPDCPDC)-3') ; × 1 AP-1 FRAGMENT FOS × 1 （P01100） AP-1 FRAGMENT JUN × 1 （P05412）	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；THE COMPLEX WAS CRYSTALLIZED IN 300-400 MM AMMONIUM ACETATE SALT, PH 7.5 (10 MM)., VAPOR DIFFUSION, HANGING DROP	Resolution 2.70 Å R-free 0.303

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1A02	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1OWR CRYSTAL STRUCTURE OF HUMAN NFAT1 BOUND MONOMERICALLY TO DNA Deposited 2003-03-29	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain M 396–678（283 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；289 K；sodium cacodylate, magnesium chloride, peg 3000, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.00 Å R-free 0.273
1OWR CRYSTAL STRUCTURE OF HUMAN NFAT1 BOUND MONOMERICALLY TO DNA Deposited 2003-03-29	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain N 396–678（283 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；289 K；sodium cacodylate, magnesium chloride, peg 3000, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.00 Å R-free 0.273
1OWR CRYSTAL STRUCTURE OF HUMAN NFAT1 BOUND MONOMERICALLY TO DNA Deposited 2003-03-29	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain P 396–678（283 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；289 K；sodium cacodylate, magnesium chloride, peg 3000, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.00 Å R-free 0.273
1OWR CRYSTAL STRUCTURE OF HUMAN NFAT1 BOUND MONOMERICALLY TO DNA Deposited 2003-03-29	Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 4 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain Q 396–678（283 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；289 K；sodium cacodylate, magnesium chloride, peg 3000, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.00 Å R-free 0.273
1P7H Structure of NFAT1 bound as a dimer to the HIV-1 LTR kB element Deposited 2003-05-01	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain L 393–678（286 aa） Fragment：NFAT1 Chain M 393–678（286 aa） Fragment：NFAT1	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；291 K；pH 8.1, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.60 Å R-free 0.265
1P7H Structure of NFAT1 bound as a dimer to the HIV-1 LTR kB element Deposited 2003-05-01	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain N 393–678（286 aa） Fragment：NFAT1 Chain O 393–678（286 aa） Fragment：NFAT1	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.1；291 K；pH 8.1, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.60 Å R-free 0.265
1PZU An asymmetric NFAT1-RHR homodimer on a pseudo-palindromic, Kappa-B site Deposited 2003-07-14	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain B 396–678（283 aa） Fragment：NFAT1 DNA-binding domain Chain D 396–678（283 aa） Fragment：NFAT1 DNA-binding domain	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions MICROBATCH；pH 8；292 K；HEPES, NaCl, glycerol, NH4OAc, MgCl2, spermine, PEG4000, Tris-HCl, pH 8.0, microbatch, temperature 292.0K	Resolution 3.10 Å R-free 0.319
1PZU An asymmetric NFAT1-RHR homodimer on a pseudo-palindromic, Kappa-B site Deposited 2003-07-14	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain H 396–678（283 aa） Fragment：NFAT1 DNA-binding domain Chain I 396–678（283 aa） Fragment：NFAT1 DNA-binding domain	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions MICROBATCH；pH 8；292 K；HEPES, NaCl, glycerol, NH4OAc, MgCl2, spermine, PEG4000, Tris-HCl, pH 8.0, microbatch, temperature 292.0K	Resolution 3.10 Å R-free 0.319
1PZU An asymmetric NFAT1-RHR homodimer on a pseudo-palindromic, Kappa-B site Deposited 2003-07-14	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 3 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain L 396–678（283 aa） Fragment：NFAT1 DNA-binding domain Chain M 396–678（283 aa） Fragment：NFAT1 DNA-binding domain	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions MICROBATCH；pH 8；292 K；HEPES, NaCl, glycerol, NH4OAc, MgCl2, spermine, PEG4000, Tris-HCl, pH 8.0, microbatch, temperature 292.0K	Resolution 3.10 Å R-free 0.319
1S9K Crystal Structure of Human NFAT1 and Fos-Jun on the IL-2 ARRE1 Site Deposited 2004-02-04	Different construct Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain C 399–678（280 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；289 K；300-400 mM Ammonium Acetate Salt, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.10 Å R-free 0.275
2AS5 Structure of the DNA binding domains of NFAT and FOXP2 bound specifically to DNA. Deposited 2005-08-22	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain N 392–678（287 aa） Fragment：NFAT1 DNA BINDING DOMAIN	Not recorded	MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；291 K；Cacodylic Acid, PEG 4k, Sodium Chloride, Magnesium Chloride, Glycerol, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.70 Å R-free 0.287
2AS5 Structure of the DNA binding domains of NFAT and FOXP2 bound specifically to DNA. Deposited 2005-08-22	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain M 392–678（287 aa） Fragment：NFAT1 DNA BINDING DOMAIN	Not recorded	MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.3；291 K；Cacodylic Acid, PEG 4k, Sodium Chloride, Magnesium Chloride, Glycerol, pH 6.3, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.70 Å R-free 0.287
2O93 Crystal structure of NFAT bound to the HIV-1 LTR tandem kappaB enhancer element Deposited 2006-12-13	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 3 PDB declaration: pentameric	Chain L 392–678（287 aa） Fragment：RHR domain Chain M 392–678（287 aa） Fragment：RHR domain Chain O 392–678（287 aa） Fragment：RHR domain	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；291 K；50mM Hepes pH 7.0, 15mM Magnesium Acetate, 250mM Ammonium Acetate, 7.5% PEG 4000, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 3.05 Å R-free 0.283
3QRF Structure of a domain-swapped FOXP3 dimer Deposited 2011-02-17	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain N 396–678（283 aa） Fragment：human NFAT1 DNA Binding Domain	Not recorded	MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.63；291 K；5 mM HEPES, pH 7.63, 2 mM dithiothreitol (DTT), 0.5 mM EDTA, and 150 mM NaCl, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.80 Å R-free 0.283
3QRF Structure of a domain-swapped FOXP3 dimer Deposited 2011-02-17	Different construct Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain M 396–678（283 aa） Fragment：human NFAT1 DNA Binding Domain	Not recorded	MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.63；291 K；5 mM HEPES, pH 7.63, 2 mM dithiothreitol (DTT), 0.5 mM EDTA, and 150 mM NaCl, VAPOR DIFFUSION, HANGING DROP, temperature 291K	Resolution 2.80 Å R-free 0.283
8OW4 2.75 angstrom crystal structure of human NFAT1 with bound DNA Deposited 2023-04-27	Different construct Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 391–678（288 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；295 K；0.1 M sodium cacodylate pH 6.0, 8% w/v PEG 8000	Resolution 2.75 Å R-free 0.273
8OW4 2.75 angstrom crystal structure of human NFAT1 with bound DNA Deposited 2023-04-27	Different construct Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 391–678（288 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 6；295 K；0.1 M sodium cacodylate pH 6.0, 8% w/v PEG 8000	Resolution 2.75 Å R-free 0.273
8R07 C-terminal Rel-homology Domain of NFAT1 Deposited 2023-10-30	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 356–459（104 aa） Chain B 356–459（104 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；pH 6.5；293 K；25% PEG 3350, 200mM Sodium Chloride and 100 mM BIS-TRIS buffer at a pH of 6.5	Resolution 1.74 Å R-free 0.184
8R3F C-terminal Rel-homology Domain of NFAT1 Deposited 2023-11-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 356–459（104 aa） Chain B 356–459（104 aa）	Not recorded	XS8 (4~{S})-6-fluoranyl-3,4-dihydro-2~{H}-chromen-4-amine × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；293 K；containing 25% PEG 3350, 200 mM Sodium Chloride and 100 mM BIS-TRIS buffer at a pH of 6.5	Resolution 1.55 Å R-free 0.236
9VRQ Crystal structure of FOXC2/NFAT1 complex bound to ARRE2 DNA Deposited 2025-07-07	Different construct Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain N 392–678（287 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；277 K；50 mM MES 5.93, 200 mM NaCl, 10 mM MgCl2, 1 mM TCEP and 12-15% PEG 4K (w/v)	Resolution 2.80 Å R-free 0.288

11 other PDB entries and 20 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	NFAC2_HUMAN
Isoform	—
PDB entities	3
Chains and sequence ranges	Author chain N； PDBConstruct 19–301； UniProt 396–678

AP-1 FRAGMENT FOS

Homo sapiens

UniProt P01100

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Heteromer Protein × 3 DNA 2 PDB declaration: pentameric（5） Consistent with all polymer counts	Chain F； UniProt 138–193	Fragment：FOS Mutation：C154S	;DNA (5'-D(DTPDTPDGPDGPDAPDAPDAPDAPDTPDTPDTPDGPDTPDTPDTPDCPDAPDTPDAPDG)-3') ; × 1 ;DNA (5'-D(DAPDAPDCPDTPDAPDTPDGPDAPDAPDAPDCPDAPDAPDAPDTPDTPDTPDTPDCPDC)-3') ; × 1 NUCLEAR FACTOR OF ACTIVATED T CELLS × 1 （Q13469） AP-1 FRAGMENT JUN × 1 （P05412）	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；THE COMPLEX WAS CRYSTALLIZED IN 300-400 MM AMMONIUM ACETATE SALT, PH 7.5 (10 MM)., VAPOR DIFFUSION, HANGING DROP	Resolution 2.70 Å R-free 0.303

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1A02	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1FOS TWO HUMAN C-FOS:C-JUN:DNA COMPLEXES Deposited 1995-03-07	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain E 139–200（62 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.7；293 K；pH 6.70, VAPOR DIFFUSION, HANGING DROP, temperature 293.00K	Resolution 3.05 Å R-free 0.321
1FOS TWO HUMAN C-FOS:C-JUN:DNA COMPLEXES Deposited 1995-03-07	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–DNA Heteromer；Protein × 2 PDB declaration: tetrameric	Chain G 139–200（62 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.7；293 K；pH 6.70, VAPOR DIFFUSION, HANGING DROP, temperature 293.00K	Resolution 3.05 Å R-free 0.321
1S9K Crystal Structure of Human NFAT1 and Fos-Jun on the IL-2 ARRE1 Site Deposited 2004-02-04	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain D 140–192（53 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；289 K；300-400 mM Ammonium Acetate Salt, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.10 Å R-free 0.275

2 other PDB entries and 3 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	FOS_HUMAN
Isoform	—
PDB entities	4
Chains and sequence ranges	Author chain F； PDBConstruct 1–56； UniProt 138–193

AP-1 FRAGMENT JUN

Homo sapiens

UniProt P05412

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Heteromer Protein × 3 DNA 2 PDB declaration: pentameric（5） Consistent with all polymer counts	Chain J； UniProt 253–308	Fragment：JUN Mutation：C279S	;DNA (5'-D(DTPDTPDGPDGPDAPDAPDAPDAPDTPDTPDTPDGPDTPDTPDTPDCPDAPDTPDAPDG)-3') ; × 1 ;DNA (5'-D(DAPDAPDCPDTPDAPDTPDGPDAPDAPDAPDCPDAPDAPDAPDTPDTPDTPDTPDCPDC)-3') ; × 1 NUCLEAR FACTOR OF ACTIVATED T CELLS × 1 （Q13469） AP-1 FRAGMENT FOS × 1 （P01100）	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION, HANGING DROP；pH 7.5；THE COMPLEX WAS CRYSTALLIZED IN 300-400 MM AMMONIUM ACETATE SALT, PH 7.5 (10 MM)., VAPOR DIFFUSION, HANGING DROP	Resolution 2.70 Å R-free 0.303

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 1A02	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1JNM Crystal Structure of the Jun/CRE Complex Deposited 2001-07-24	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 254–315（62 aa） Fragment：bZIP domain Chain B 254–315（62 aa） Fragment：bZIP domain	Mutation：C269S Mutation：C269S	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；298 K；PEG 4000, Cacodylate, sodium chloride, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 2.20 Å R-free 0.286
1JUN NMR STUDY OF C-JUN HOMODIMER Deposited 1995-12-19	Different construct Different mutation/modification Different oligomeric state Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 2–44（43 aa） Fragment：LEUCINE ZIPPER DOMAIN, RESIDUES 272 - 315 Chain B 2–44（43 aa） Fragment：LEUCINE ZIPPER DOMAIN, RESIDUES 272 - 315	Mutation：INS(272-275), INS(315) Non-standard monomer：Yes (specific site not provided by mmCIF) Mutation：INS(272-275), INS(315) Non-standard monomer：Yes (specific site not provided by mmCIF)	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 3.6；310 K	Resolution not provided
1S9K Crystal Structure of Human NFAT1 and Fos-Jun on the IL-2 ARRE1 Site Deposited 2004-02-04	Different construct Different mutation/modification Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 3 PDB declaration: pentameric	Chain E 257–308（52 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；289 K；300-400 mM Ammonium Acetate Salt, pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 289K	Resolution 3.10 Å R-free 0.275
1T2K Structure Of The DNA Binding Domains Of IRF3, ATF-2 and Jun Bound To DNA Deposited 2004-04-21	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain C 254–314（61 aa） Fragment：bZip domain	Mutation：C269S	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；295 K；100 mM NaCacodylate, pH 6.5, 12.5% (w/v) PEG 6000, 400 mM NH4OAc, VAPOR DIFFUSION, HANGING DROP, temperature 295K	Resolution 3.00 Å R-free 0.296
5T01 Human c-Jun DNA binding domain homodimer in complex with methylated DNA Deposited 2016-08-15	Different construct Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 254–315（62 aa） Fragment：DNA binding domain (UNP residues 254-315) Chain B 254–315（62 aa） Fragment：DNA binding domain (UNP residues 254-315)	Mutation：C269S Mutation：C269S	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 5；289 K；0.05 M Citric acid 0.05 M Bis-Tris propane 16% PEG3350	Resolution 1.89 Å R-free 0.227

5 other PDB entries and 5 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	AP1_HUMAN
Isoform	—
PDB entities	5
Chains and sequence ranges	Author chain J； PDBConstruct 1–56； UniProt 253–308

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	1a02
Deposition date deposition_date	1997-12-08
Structure title title	STRUCTURE OF THE DNA BINDING DOMAINS OF NFAT, FOS AND JUN BOUND TO DNA
Keywords keywords	;TRANSCRIPTION FACTOR, NFAT, NF-AT, AP-1, FOS-JUN, QUATERNARY PROTEIN-DNA COMPLEX, TRANSCRIPTION SYNERGY, COMBINATORIAL GENE REGULATION, TRANSCRIPTION-DNA COMPLEX ;; TRANSCRIPTION/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	26.88 Å
Radius of gyration Rg (electron density) rg_electron	25.98 Å
Forward intensity I(0) i0	69842100.00
Molecular weight molecular_weight	56004.0 kDa
Excluded volume excluded_volume	66281 Å³
Envelope volume envelope_volume	88672 Å³
Hydration-shell volume shell_volume	29290 Å³
Envelope diameter envelope_diameter	96.8 Å
Shell Rg shell_rg	32.44 Å
Envelope Rg envelope_rg	26.00 Å
Shape Rg shape_rg	25.92 Å
Total Rg total_rg	26.76 Å
Total atoms total_atoms	3886
Residues n_residues	425
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	93.4 Å
Rg (real space) rg_real	26.86 Å
Rg uncertainty (real space) rg_real_error	0.73 Å
I(0) (real space) i0_real	6.9840e+07
I(0) uncertainty (real space) i0_real_error	1.0230e+06
Rg (reciprocal space) rg_reciprocal	26.86 Å
I(0) (reciprocal space) i0_reciprocal	69840000.0000
Solution quality estimate total_estimate	0.8709
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	2
Primary peak position r_peak_primary	34.8 Å
Skewness Skewness skewness	0.323
Kurtosis Kurtosis kurtosis	-0.227
Angular range angular_range	— – 0.2950 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	10030000.0000
Real-space data points n_real_points	60
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.796; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.940; Smooth: 0.990

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Description description	;DNA (5'-D(DTPDTPDGPDGPDAPDAPDAPDAPDTPDTPDTPDGPDTPDTPDTPDCPDAPDTPDAPDG)-3') ;
Molecular weight formula_weight	6178.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	A
Atom count atom_count	3974

TTGGAAAATTTGTTTCATAG

Entity 2 Entity 2 polymer

Description description	;DNA (5'-D(DAPDAPDCPDTPDAPDTPDGPDAPDAPDAPDCPDAPDAPDAPDTPDTPDTPDTPDCPDC)-3') ;
Molecular weight formula_weight	6085.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B

AACTATGAAACAAATTTTCC

Entity 3 Entity 3 polymer

Description description	NUCLEAR FACTOR OF ACTIVATED T CELLS
Molecular weight formula_weight	34270.9 kDa
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	N

MRGSHHHHHHTDPHASSVPLEWPLSSQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHIPESSGRIVSLQTASNPIECSQRSAHELPMVERQDTDSCLVYGGQQMILTGQNFTSESKVVFTEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRTPVKVNFYVINGKRKRSQPQHFTYHPV

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli BL21(DE3)

Entity 4 Entity 4 polymer

Description description	AP-1 FRAGMENT FOS
Molecular weight formula_weight	6727.7 kDa
Mutation mutation	C154S
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	F

MKRRIRRERNKMAAAKSRNRRRELTDTLQAETDQLEDEKSALQTEIANLLKEKEKL

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 5 Entity 5 polymer

Description description	AP-1 FRAGMENT JUN
Molecular weight formula_weight	6583.8 kDa
Mutation mutation	C279S
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	J

MKAERKRMRNRIAASKSRKRKLERIARLEEKVKTLKAQNSELASTANMLREQVAQL

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 6 Entity 6 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	88

▼

7. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

Domain ID domain_id	d1a02f_
Class class	h — Coiled coil proteins
Fold Fold fold	h.1 — Parallel coiled-coil
Superfamily Superfamily superfamily	h.1.3 — Leucine zipper domain
Family Family family	h.1.3.1 — Leucine zipper domain

Domain ID domain_id	d1a02j_
Class class	h — Coiled coil proteins
Fold Fold fold	h.1 — Parallel coiled-coil
Superfamily Superfamily superfamily	h.1.3 — Leucine zipper domain
Family Family family	h.1.3.1 — Leucine zipper domain

Domain ID domain_id	d1a02n1
Class class	b — All beta proteins
Fold Fold fold	b.1 — Immunoglobulin-like beta-sandwich
Superfamily Superfamily superfamily	b.1.18 — E set domains
Family Family family	b.1.18.1 — NF-kappa-B/REL/DORSAL transcription factors, C-terminal domain

Domain ID domain_id	d1a02n2
Class class	b — All beta proteins
Fold Fold fold	b.2 — Common fold of diphtheria toxin/transcription factors/cytochrome f
Superfamily Superfamily superfamily	b.2.5 — p53-like transcription factors
Family Family family	b.2.5.3 — Rel/Dorsal transcription factors, DNA-binding domain

CATH v4.4 (4 domains)

Domain ID domain_id	1a02F00
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	5 — Single alpha-helices involved in coiled-coils or other helix-helix interfaces
Homologous superfamily homologous superfamily	170 —

Domain ID domain_id	1a02J00
Class class	1 — Mainly Alpha
Architecture architecture	20 — Up-down Bundle
Topology topology	5 — Single alpha-helices involved in coiled-coils or other helix-helix interfaces
Homologous superfamily homologous superfamily	170 —

Domain ID domain_id	1a02N01
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	340 — Rel homology domain (RHD), DNA-binding domain

Domain ID domain_id	1a02N02
Class class	2 — Mainly Beta
Architecture architecture	60 — Sandwich
Topology topology	40 — Immunoglobulin-like
Homologous superfamily homologous superfamily	10 — Immunoglobulins

▶

8. Citations (1)

▶

Unit-cell length a length_a	64.660 Å
Unit-cell length b length_b	85.460 Å
Unit-cell length c length_c	83.370 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	112.03 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	2

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.700 Å
Low-resolution limit resolution_low	10.000 Å
R factor r_factor	0.2460
R_work r_work	0.2460
R_free r_free	0.3030

fit	/app/data/saxs_computation/a0/1a02/1a02.fit
pddf	/app/data/pr_computation/a0/1a02/1a02.pr.out
profile	/app/data/saxs_computation/a0/1a02/1a02.dat

STRUCTURE OF THE DNA BINDING DOMAINS OF NFAT, FOS AND JUN BOUND TO DNA

1. Protein Identity and Related Structures Protein Identity & Related Structures

NUCLEAR FACTOR OF ACTIVATED T CELLS

State in the Current Structure

Other States of the Same Protein in the Database

AP-1 FRAGMENT FOS

State in the Current Structure

Other States of the Same Protein in the Database

AP-1 FRAGMENT JUN

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (6)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

来源 Source

Entity 4 Entity 4 polymer

Polymer Polymer

来源 Source

Entity 5 Entity 5 polymer

Polymer Polymer

来源 Source

Entity 6 Entity 6 water

7. Fold Classification (SCOP + CATH) 8 domains

SCOP 2.08 (4 domains)

CATH v4.4 (4 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)