6voy

Cryo-EM structure of HTLV-1 instasome

Method: ELECTRON MICROSCOPY D_max: 165.3 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-binding protein 7d

Human T-cell leukemia virus type I

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Insufficient information Heteromer Protein × 6 DNA 6 PDB declaration: dodecameric（12） Consistent with all polymer counts	Chain A； UniProt 569–863 Chain B； UniProt 569–863 Chain C； UniProt 569–863 Chain D； UniProt 569–863	Mutation：W24A	Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform × 2 （Q13362） ;DNA (5'-D(PAPCPAPCPAPCPTPTPGPAPCPTPAPGPGPGPTPG)-3') ; × 2 DNA (25-MER) × 2 ;DNA (5'-D(PAPCPAPCPAPCPTPTPGPAPCPTPAPGPGPGPTPG)-3') ; × 2 ZN ZINC ION × 4 MG MAGNESIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen NITROGEN	Resolution 3.70 Å

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

No other PDB entry for the same UniProt protein was found.

View Construct and Data Evidence

UniProt name	A0A1Y1CAW1_9DELA
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 96–390； UniProt 569–863 Author chain B； PDBConstruct 96–390； UniProt 569–863 Author chain C； PDBConstruct 96–390； UniProt 569–863 Author chain D； PDBConstruct 96–390； UniProt 569–863

DNA-binding protein 7d

Human T-cell leukemia virus type I

UniProt P39476

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Insufficient information Heteromer Protein × 6 DNA 6 PDB declaration: dodecameric（12） Consistent with all polymer counts	Chain A； UniProt 1–64 Chain B； UniProt 1–64 Chain C； UniProt 1–64 Chain D； UniProt 1–64	Mutation：W24A	Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform × 2 （Q13362） ;DNA (5'-D(PAPCPAPCPAPCPTPTPGPAPCPTPAPGPGPGPTPG)-3') ; × 2 DNA (25-MER) × 2 ;DNA (5'-D(PAPCPAPCPAPCPTPTPGPAPCPTPAPGPGPGPTPG)-3') ; × 2 ZN ZINC ION × 4 MG MAGNESIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen NITROGEN	Resolution 3.70 Å

Other States of the Same Protein in the Database

Other PDB	Difference from Current Entry 6VOY	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1BBX NON-SPECIFIC PROTEIN-DNA INTERACTIONS IN THE SSO7D-DNA COMPLEX, NMR, 1 STRUCTURE Deposited 1998-04-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain C 1–63（63 aa） Chain D 1–63（63 aa）	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 5；323 K；Ionic strength (raw mmCIF value) 60 mM；Pressure 1 NMR sample composition H2O:D2O 9:1	Resolution not provided
1C8C CRYSTAL STRUCTURES OF THE CHROMOSOMAL PROTEINS SSO7D/SAC7D BOUND TO DNA CONTAINING T-G MISMATCHED BASE PAIRS Deposited 2000-05-04	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.5；PROTEIN WAS CRYSTALLIZED FROM 1.3MM SSO7D, 1.3MM DUPLEX DNA, 2.5 MM TRIS (PH 6.5), 2.5% PEG 400, EQUILIBRATED AGAINST 15% PEG 400 at pH 6.5, VAPOR DIFFUSION, HANGING DROP	Resolution 1.45 Å R-free 0.287
1JIC SOLUTION NMR STRUCTURE OF RECOMBINANT SSO7D WITH RNASE ACTIVITY, MINIMIZED AVERAGE STRUCTURE Deposited 1998-07-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–62（62 aa）	Not recorded	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 4.5；300 K NMR sample composition H2O	Resolution not provided
5B02 Structure of the prenyltransferase MoeN5 with a fusion protein tag of Sso7d Deposited 2015-10-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350	Resolution 2.21 Å R-free 0.218
5B02 Structure of the prenyltransferase MoeN5 with a fusion protein tag of Sso7d Deposited 2015-10-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350	Resolution 2.21 Å R-free 0.218
5B03 Structure of MoeN5-Sso7d fusion protein in complex with geranyl pyrophosphate Deposited 2015-10-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	GPP GERANYL DIPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 5mM GPP, 0.3M Li3-citrate, 0.4M NaCl, 27% PEG 3350, 5% glycerol	Resolution 2.60 Å R-free 0.239
5B03 Structure of MoeN5-Sso7d fusion protein in complex with geranyl pyrophosphate Deposited 2015-10-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	GPP GERANYL DIPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 5mM GPP, 0.3M Li3-citrate, 0.4M NaCl, 27% PEG 3350, 5% glycerol	Resolution 2.60 Å R-free 0.239
5B0I Structure of MoeN5-Sso7d fusion protein in complex with beta-octyl glucoside Deposited 2015-10-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	BOG octyl beta-D-glucopyranoside × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 5% Glycerol, 1% beta-octyl glucoside	Resolution 2.26 Å R-free 0.229
5B0I Structure of MoeN5-Sso7d fusion protein in complex with beta-octyl glucoside Deposited 2015-10-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	BOG octyl beta-D-glucopyranoside × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 5% Glycerol, 1% beta-octyl glucoside	Resolution 2.26 Å R-free 0.229
5B0J Structure of MoeN5-Sso7d fusion protein in complex with beta-undecyl maltoside Deposited 2015-10-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% undecylmaltoside	Resolution 2.50 Å R-free 0.238
5B0J Structure of MoeN5-Sso7d fusion protein in complex with beta-undecyl maltoside Deposited 2015-10-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	UMQ UNDECYL-MALTOSIDE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% undecylmaltoside	Resolution 2.50 Å R-free 0.238
5B0K Structure of MoeN5-Sso7d fusion protein in complex with beta-decyl maltoside Deposited 2015-10-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	DMU DECYL-BETA-D-MALTOPYRANOSIDE × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 5% glycerol, 1% beta-decyl-D-maltoside	Resolution 2.75 Å R-free 0.248
5B0K Structure of MoeN5-Sso7d fusion protein in complex with beta-decyl maltoside Deposited 2015-10-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	DMU DECYL-BETA-D-MALTOPYRANOSIDE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 5% glycerol, 1% beta-decyl-D-maltoside	Resolution 2.75 Å R-free 0.248
5B0L Structure of MoeN5-Sso7d fusion protein in complex with beta-nonyl glucoside Deposited 2015-11-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	BNG nonyl beta-D-glucopyranoside × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% beta-nonyl-D-glucoside	Resolution 2.80 Å R-free 0.232
5B0L Structure of MoeN5-Sso7d fusion protein in complex with beta-nonyl glucoside Deposited 2015-11-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	BNG nonyl beta-D-glucopyranoside × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% beta-nonyl-D-glucoside	Resolution 2.80 Å R-free 0.232
5B0L Structure of MoeN5-Sso7d fusion protein in complex with beta-nonyl glucoside Deposited 2015-11-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain E 1–64（64 aa） Chain F 1–64（64 aa）	Not recorded	BNG nonyl beta-D-glucopyranoside × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% beta-nonyl-D-glucoside	Resolution 2.80 Å R-free 0.232
5B0L Structure of MoeN5-Sso7d fusion protein in complex with beta-nonyl glucoside Deposited 2015-11-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain G 1–64（64 aa） Chain H 1–64（64 aa）	Not recorded	BNG nonyl beta-D-glucopyranoside × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% beta-nonyl-D-glucoside	Resolution 2.80 Å R-free 0.232
5B0M Structure of MoeN5-Sso7d fusion protein in complex with beta-dodecyl maltoside Deposited 2015-11-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% beta-dodecyl-D-maltoside	Resolution 3.05 Å R-free 0.249
5B0M Structure of MoeN5-Sso7d fusion protein in complex with beta-dodecyl maltoside Deposited 2015-11-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% beta-dodecyl-D-maltoside	Resolution 3.05 Å R-free 0.249
5B0M Structure of MoeN5-Sso7d fusion protein in complex with beta-dodecyl maltoside Deposited 2015-11-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain E 1–64（64 aa） Chain F 1–64（64 aa）	Not recorded	LMT DODECYL-BETA-D-MALTOSIDE × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% beta-dodecyl-D-maltoside	Resolution 3.05 Å R-free 0.249
5B0M Structure of MoeN5-Sso7d fusion protein in complex with beta-dodecyl maltoside Deposited 2015-11-02	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 4 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain G 1–64（64 aa） Chain H 1–64（64 aa）	Not recorded	LMT DODECYL-BETA-D-MALTOSIDE × 5	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M Li3-citrate, 0.3M NaCl, 25% PEG 3350, 1% beta-dodecyl-D-maltoside	Resolution 3.05 Å R-free 0.249
5GWV Structure of MoeN5-Sso7d fusion protein in complex with a substrate analogue Deposited 2016-09-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；Protein: 10mg/mL in 10mM DTT, 1mM MgCl2 Reservoir: 0.2M Li3-citrate, 0.3M NaCl, 25% w/v PEG 3350 Cryoprotectant: 5mM substrate analogue in 0.3M Li3-citrate, 0.4M NaCl, 27% w/v PEG 3350, 5% glycerol	Resolution 2.40 Å R-free 0.216
5GWV Structure of MoeN5-Sso7d fusion protein in complex with a substrate analogue Deposited 2016-09-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	78S (2R)-3-dimethoxyphosphoryloxy-2-[(2Z,6E)-3,7,11-trimethyldodeca-2,6,10-trienoxy]propanoic acid × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；Protein: 10mg/mL in 10mM DTT, 1mM MgCl2 Reservoir: 0.2M Li3-citrate, 0.3M NaCl, 25% w/v PEG 3350 Cryoprotectant: 5mM substrate analogue in 0.3M Li3-citrate, 0.4M NaCl, 27% w/v PEG 3350, 5% glycerol	Resolution 2.40 Å R-free 0.216
5GWW Structure of MoeN5-Sso7d fusion protein in complex with a permethylated substrate analogue Deposited 2016-09-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；protein: 10 mg/mL in 10 mM DTT, 1 mM MgCl2 reservoir: 0.2 M Li3 citrate, 0.3 M NaCl, 25% w/v PEG 3350 cryoprotectant: 5 mM permethylated analogue, 0.3 M Li3 citrate, 0.4 M NaCl, 27% w/v PEG 3350, 5% glycerol	Resolution 2.30 Å R-free 0.221
5GWW Structure of MoeN5-Sso7d fusion protein in complex with a permethylated substrate analogue Deposited 2016-09-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	7B5 methyl (2R)-3-dimethoxyphosphoryloxy-2-[(2Z,6E)-3,7,11-trimethyldodeca-2,6,10-trienoxy]propanoate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；protein: 10 mg/mL in 10 mM DTT, 1 mM MgCl2 reservoir: 0.2 M Li3 citrate, 0.3 M NaCl, 25% w/v PEG 3350 cryoprotectant: 5 mM permethylated analogue, 0.3 M Li3 citrate, 0.4 M NaCl, 27% w/v PEG 3350, 5% glycerol	Resolution 2.30 Å R-free 0.221
6J8V Structure of MOEN5-SSO7D fusion protein in complex with ligand 2 Deposited 2019-01-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M LI3-CITRATE, 0.3M NACL, 25% W/V PEG 3350	Resolution 2.23 Å R-free 0.225
6J8V Structure of MOEN5-SSO7D fusion protein in complex with ligand 2 Deposited 2019-01-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	FAR FARNESYL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M LI3-CITRATE, 0.3M NACL, 25% W/V PEG 3350	Resolution 2.23 Å R-free 0.225
6J8W Structure of MOEN5-SSO7D fusion protein in complex with lig 1 Deposited 2019-01-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1–64（64 aa） Chain B 1–64（64 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M LI3-CITRATE, 0.3M NACL, 25% W/V PEG 3350	Resolution 2.35 Å R-free 0.225
6J8W Structure of MOEN5-SSO7D fusion protein in complex with lig 1 Deposited 2019-01-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	C0X (2S)-3-dimethoxyphosphoryloxy-2-[(2E,6E)-3,7,11-trimethyldodeca-2,6,10-trienoxy]propanoic acid × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8.1；298 K；0.2M LI3-CITRATE, 0.3M NACL, 25% W/V PEG 3350	Resolution 2.35 Å R-free 0.225
6PUT Structure of HIV cleaved synaptic complex (CSC) intasome bound with calcium Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 8 PDB declaration: dodecameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	CA CALCIUM ION × 4 ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å R-free 0.536
6PUT Structure of HIV cleaved synaptic complex (CSC) intasome bound with calcium Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	CA CALCIUM ION × 2 ZN ZINC ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å R-free 0.536
6PUT Structure of HIV cleaved synaptic complex (CSC) intasome bound with calcium Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	CA CALCIUM ION × 2 ZN ZINC ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å R-free 0.536
6PUW Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and Bictegravir (BIC) Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 8 PDB declaration: dodecameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 4 ZN ZINC ION × 4 KLQ Bictegravir × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å R-free 0.534
6PUW Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and Bictegravir (BIC) Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 2 ZN ZINC ION × 2 KLQ Bictegravir × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å R-free 0.534
6PUW Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and Bictegravir (BIC) Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 2 ZN ZINC ION × 2 KLQ Bictegravir × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.90 Å R-free 0.534
6PUY Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ426 (compound 4d) Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 8 PDB declaration: dodecameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 4 ZN ZINC ION × 4 OZ1 4-amino-N-[(2,4-difluorophenyl)methyl]-1-hydroxy-6-(6-hydroxyhexyl)-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å R-free 0.516
6PUY Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ426 (compound 4d) Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 2 ZN ZINC ION × 2 OZ1 4-amino-N-[(2,4-difluorophenyl)methyl]-1-hydroxy-6-(6-hydroxyhexyl)-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å R-free 0.516
6PUY Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ426 (compound 4d) Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 2 ZN ZINC ION × 2 OZ1 4-amino-N-[(2,4-difluorophenyl)methyl]-1-hydroxy-6-(6-hydroxyhexyl)-2-oxo-1,2-dihydro-1,8-naphthyridine-3-carboxamide × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å R-free 0.516
6PUZ Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ446 (compound 4f) Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 8 PDB declaration: dodecameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 4 ZN ZINC ION × 4 XXJ 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-[2-(phenylsulfonyl)ethyl]-1,8-naphthyridine-3-carboxamide × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å R-free 0.535
6PUZ Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ446 (compound 4f) Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 2 ZN ZINC ION × 2 XXJ 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-[2-(phenylsulfonyl)ethyl]-1,8-naphthyridine-3-carboxamide × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å R-free 0.535
6PUZ Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ446 (compound 4f) Deposited 2019-07-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 2 ZN ZINC ION × 2 XXJ 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-[2-(phenylsulfonyl)ethyl]-1,8-naphthyridine-3-carboxamide × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å R-free 0.535
6V3K Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ419 (compound 4c) Deposited 2019-11-25	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Homooligomer；Protein × 8 PDB declaration: dodecameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 4 ZN ZINC ION × 4 QUW 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å R-free 0.555
6V3K Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ419 (compound 4c) Deposited 2019-11-25	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 2 ZN ZINC ION × 2 QUW 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å R-free 0.555
6V3K Structure of HIV cleaved synaptic complex (CSC) intasome bound with magnesium and INSTI XZ419 (compound 4c) Deposited 2019-11-25	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Insufficient information Homooligomer；Protein × 4 PDB declaration: hexameric	Chain A 1–64（64 aa） Chain B 1–64（64 aa） Chain C 1–64（64 aa） Chain D 1–64（64 aa）	Not recorded	MG MAGNESIUM ION × 2 ZN ZINC ION × 2 QUW 4-azanyl-N-[[2,4-bis(fluoranyl)phenyl]methyl]-1-oxidanyl-2-oxidanylidene-6-(5-oxidanylpentyl)-1,8-naphthyridine-3-carboxamide × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 6.2 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å R-free 0.555

19 other PDB entries and 44 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	DN7D_SACS2
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 21–84； UniProt 1–64 Author chain B； PDBConstruct 21–84； UniProt 1–64 Author chain C； PDBConstruct 21–84； UniProt 1–64 Author chain D； PDBConstruct 21–84； UniProt 1–64

Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform

Homo sapiens

UniProt Q13362

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Insufficient information Heteromer Protein × 6 DNA 6 PDB declaration: dodecameric（12） Consistent with all polymer counts	Chain E； UniProt 30–372 Chain F； UniProt 30–372	Not recorded	DNA-binding protein 7d × 4 （P39476,A0A1Y1CAW1） ;DNA (5'-D(PAPCPAPCPAPCPTPTPGPAPCPTPAPGPGPGPTPG)-3') ; × 2 DNA (25-MER) × 2 ;DNA (5'-D(PAPCPAPCPAPCPTPTPGPAPCPTPAPGPGPGPTPG)-3') ; × 2 ZN ZINC ION × 4 MG MAGNESIUM ION × 2	ELECTRON MICROSCOPY cryo-EM buffer：pH 7.5 cryo-EM vitrification conditions：Cryogen NITROGEN	Resolution 3.70 Å

Other States of the Same Protein in the Database

Other PDB	Difference from Current Entry 6VOY	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
2IAE Crystal structure of a protein phosphatase 2A (PP2A) holoenzyme. Deposited 2006-09-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain B 30–436（407 aa） Fragment：B56gamma1 subunit, residues 30-436	Not recorded	MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；298 K；0.1M MES, pH 7.0, 50mM NaCl, 1.4M ammonium sulfate, 0.2M LiCl, 2% 1,6-diaminohexane, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 3.50 Å R-free 0.316
2IAE Crystal structure of a protein phosphatase 2A (PP2A) holoenzyme. Deposited 2006-09-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain E 30–436（407 aa） Fragment：B56gamma1 subunit, residues 30-436	Not recorded	MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；298 K；0.1M MES, pH 7.0, 50mM NaCl, 1.4M ammonium sulfate, 0.2M LiCl, 2% 1,6-diaminohexane, VAPOR DIFFUSION, HANGING DROP, temperature 298K	Resolution 3.50 Å R-free 0.316
2JAK Human PP2A regulatory subunit B56g Deposited 2006-11-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 11–380（370 aa） Fragment：RESIDUES 11-380	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions 29% MPD 0.1M TRIS, PH 8.0 20MM L-PROLINE	Resolution 2.60 Å R-free 0.260
2NPP Structure of the Protein Phosphatase 2A Holoenzyme Deposited 2006-10-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain E 1–439（439 aa）	Not recorded	MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；277.5 K；15% PEG 8000, 0.1 M Tris-Cl pH 8.5, and 0.2 M magnesium sulfate, VAPOR DIFFUSION, HANGING DROP, temperature 277.5K	Resolution 3.30 Å R-free 0.299
2NPP Structure of the Protein Phosphatase 2A Holoenzyme Deposited 2006-10-28	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain B 1–439（439 aa）	Not recorded	MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；277.5 K；15% PEG 8000, 0.1 M Tris-Cl pH 8.5, and 0.2 M magnesium sulfate, VAPOR DIFFUSION, HANGING DROP, temperature 277.5K	Resolution 3.30 Å R-free 0.299
2NYL Crystal structure of Protein Phosphatase 2A (PP2A) holoenzyme with the catalytic subunit carboxyl terminus truncated Deposited 2006-11-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain B 38–425（388 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；277 K；10-15% PEG8000, 0.1 M Tris-Cl, 0.2 M magnesium sulfate, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 3.80 Å R-free 0.335
2NYL Crystal structure of Protein Phosphatase 2A (PP2A) holoenzyme with the catalytic subunit carboxyl terminus truncated Deposited 2006-11-20	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain E 38–425（388 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；277 K；10-15% PEG8000, 0.1 M Tris-Cl, 0.2 M magnesium sulfate, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 3.80 Å R-free 0.335
2NYM Crystal Structure of Protein Phosphatase 2A (PP2A) with C-terminus truncated catalytic subunit Deposited 2006-11-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain B 38–425（388 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；277 K；10-15% PEG8000, 0.1 M Tris-Cl, 0.2 M magnesium sulfate, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 3.60 Å R-free 0.331
2NYM Crystal Structure of Protein Phosphatase 2A (PP2A) with C-terminus truncated catalytic subunit Deposited 2006-11-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain E 38–425（388 aa）	Non-standard monomer：Yes (specific site not provided by mmCIF)	MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；277 K；10-15% PEG8000, 0.1 M Tris-Cl, 0.2 M magnesium sulfate, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 3.60 Å R-free 0.331
3FGA Structural Basis of PP2A and Sgo interaction Deposited 2008-12-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 5 PDB declaration: pentameric	Chain B 34–436（403 aa） Fragment：sequence database residues 34-436	Not recorded	MN MANGANESE (II) ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions EVAPORATION；pH 7；295 K；0.2 M SCTD, 20% w/v Polyethylene glycol 3,350, pH 7, EVAPORATION, temperature 295K	Resolution 2.70 Å R-free 0.277
5JJA Crystal structure of a PP2A B56gamma/BubR1 complex Deposited 2016-04-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 30–380（351 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277 K；0.1 M HEPES pH 7.5 and 20% PEG 3350	Resolution 2.35 Å R-free 0.204
5JJA Crystal structure of a PP2A B56gamma/BubR1 complex Deposited 2016-04-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 2 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain B 30–380（351 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；277 K；0.1 M HEPES pH 7.5 and 20% PEG 3350	Resolution 2.35 Å R-free 0.204
5K6S The structure of the PP2A B56 subunit BubR1 complex Deposited 2016-05-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 62–411（350 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.75；298 K；8% PEG 6K, 0.8 M HEPES, 0.8 M LiCl	Resolution 2.79 Å R-free 0.227
5SW9 The structure of the PP2A B56 subunit RepoMan complex Deposited 2016-08-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 62–411（350 aa） Fragment：UNP residues 62-411	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.75；298 K；8% PEG 8K, 0.8 M HEPES, 0.8 M LiCl	Resolution 2.85 Å R-free 0.227
5SWF The structure of the PP2A B56 subunit double phosphorylated BubR1 complex Deposited 2016-08-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 62–411（350 aa） Fragment：UNP residues 62-411	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.75；298 K；8% PEG 8k, 0.8 M HEPES, 0.8 M LiCl	Resolution 2.82 Å R-free 0.231
6OYL The structure of the PP2A B56 subunit KIF4A complex Deposited 2019-05-14	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 62–411（350 aa） Fragment：UNP residues 62-411	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.75；298 K；0.1 M HEPES, pH 7.75, 0.8 M lithium chloride, 8% PEG8000	Resolution 3.15 Å R-free 0.231
6TOQ Crystal structure of a PP2A B56y/HTLV-1 integrase complex Deposited 2019-12-11	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain AAA 11–380（370 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；293.15 K；0.1 M Na/KPO4 pH 6.2, 20-% 1,2-propanediol, 10% glycerol	Resolution 3.16 Å R-free 0.294
6VRO The structure of the PP2A B56 subunit AIM1 complex Deposited 2020-02-08	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 62–411（350 aa） Fragment：UNP residues 62-411	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；289 K；0.1 M Tris, pH 8.0, 9% PEG8000, 0.9 M lithium chloride	Resolution 2.45 Å R-free 0.235
7OUF Structure of the STLV intasome:B56 complex bound to the strand-transfer inhibitor XZ450 Deposited 2021-06-11	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: decameric	Chain C 11–380（370 aa） Chain F 11–380（370 aa）	Not recorded	ZN ZINC ION × 4 MG MAGNESIUM ION × 4 1L0 4-azanyl-~{N}-[[2,4-bis(fluoranyl)phenyl]methyl]-6-[3-(dimethylamino)-3-oxidanylidene-propyl]-1-oxidanyl-2-oxidanylidene-1,8-naphthyridine-3-carboxamide × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
7OUG STLV-1 intasome:B56 in complex with the strand-transfer inhibitor raltegravir Deposited 2021-06-11	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: decameric	Chain C 11–380（370 aa） Chain F 11–380（370 aa）	Not recorded	ZN ZINC ION × 4 MG MAGNESIUM ION × 4 RLT N-(4-fluorobenzyl)-5-hydroxy-1-methyl-2-(1-methyl-1-{[(5-methyl-1,3,4-oxadiazol-2-yl)carbonyl]amino}ethyl)-6-oxo-1,6-di hydropyrimidine-4-carboxamide × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
7PEL CryoEM structure of simian T-cell lymphotropic virus intasome in complex with PP2A regulatory subunit B56 gamma Deposited 2021-08-10	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Insufficient information Heteromer；Protein × 6 PDB declaration: decameric	Chain C 11–380（370 aa） Chain F 11–380（370 aa）	Not recorded	ZN ZINC ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 6 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.34 Å
7SOY The structure of the PP2A-B56gamma1 holoenzyme-PME-1 complex Deposited 2021-11-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 4 PDB declaration: tetrameric	Chain B 1–449（449 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å
9GNJ Crystal structure of a PP2A B56gamma double phosphorylated BRCA2 complex Deposited 2024-09-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 2 PDB declaration: dimeric	Chain A 30–380（351 aa）	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；18% de PEG3350, 100mM Bis-Tris propane, 200 mM de Sodium Citrate	Resolution 2.85 Å R-free 0.229
9MF5 CryoEM structure of the Protein Phosphatase 2A (Abeta-B56gamma-Calpha) holoenzyme complex Deposited 2024-12-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 3 PDB declaration: trimeric	Chain B 1–524（524 aa）	Not recorded	MN MANGANESE (II) ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
9MIP CryoEM structure of the Protein Phasphatase 2A (Aalpha-B56gamma-Calpha) holoenzyme complex Deposited 2024-12-13	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein heterocomplex Heteromer；Protein × 3 PDB declaration: trimeric	Chain B 1–524（524 aa）	Not recorded	MN MANGANESE (II) ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.4 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å

20 other PDB entries and 25 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	2A5G_HUMAN
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain E； PDBConstruct 1–343； UniProt 30–372 Author chain F； PDBConstruct 1–343； UniProt 30–372

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	6voy
Deposition date deposition_date	2020-02-01
Structure title title	Cryo-EM structure of HTLV-1 instasome
Keywords keywords	Integrase, Intasome, DNA BINDING PROTEIN-DNA complex; DNA BINDING PROTEIN/DNA
Experimental Method method	ELECTRON MICROSCOPY

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	48.76 Å
Radius of gyration Rg (electron density) rg_electron	49.35 Å
Forward intensity I(0) i0	1172770000.00
Molecular weight molecular_weight	252150.0 kDa
Excluded volume excluded_volume	301940 Å³
Envelope volume envelope_volume	480700 Å³
Hydration-shell volume shell_volume	82412 Å³
Envelope diameter envelope_diameter	165.1 Å
Shell Rg shell_rg	51.44 Å
Envelope Rg envelope_rg	49.00 Å
Shape Rg shape_rg	49.34 Å
Total Rg total_rg	49.46 Å
Total atoms total_atoms	17556
Residues n_residues	1904
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	165.3 Å
Rg (real space) rg_real	48.78 Å
Rg uncertainty (real space) rg_real_error	1.40 Å
I(0) (real space) i0_real	1.1730e+09
I(0) uncertainty (real space) i0_real_error	1.9300e+07
Rg (reciprocal space) rg_reciprocal	48.76 Å
I(0) (reciprocal space) i0_reciprocal	1173000000.0000
Solution quality estimate total_estimate	0.8764
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	51.6 Å
Skewness Skewness skewness	0.348
Kurtosis Kurtosis kurtosis	-0.397
Angular range angular_range	— – 0.1600 Å⁻¹
Current regularization parameter α current_alpha	0.0000
Highest regularization parameter α highest_alpha	99210000.0000
Real-space data points n_real_points	33
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.841; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 1.000; Smooth: 0.868

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	DNA-binding protein 7d
Molecular weight formula_weight	43652.7 kDa
Mutation mutation	W24A
Source method src_method	man
Copy count entity_count	4

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D
Atom count atom_count	17556

MGSSHHHHHHSSGLVPRGSHMATVKFKYKGEEKEVDISKIKKVARVGKMISFTYDEGGGKTGEGAVSEKDAPKELLQMLEKQKKGGSLEVLFQGPSPAELHSFTHCGQTALTLQGATTTEASNILRSCHACRKNNPQHQMPRGHIRRGLLPNHIWQGDITHFKYKNTLYRLHVWVDTFSGAISATQKRKETSSEAISSLLQAIAYLGKPSYINTDNGPAYISQDFLNMCTSLAIRHTTHVPYNPTSSGLVQRSNGILKTLLYKYFTDKPDLPMDNALSIALWTINHLNVLTNCHKTRWQLHHSPRLQPIPETRSLSNKQTHWYYFKLPGLNSRQWKGPQEALQEAAGAALIPVSASSAQWIPWRLLKRAACPRPVGGPADPKEKDHQHHG

来源 Source

来源生物 organism	Human T-cell leukemia virus type I
NCBI Class编号 ncbi_taxonomy_id	11908
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform
Molecular weight formula_weight	40357.8 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	E,F

IRDVPPADQEKLFIQKLRQCCVLFDFVSDPLSDLKWKEVKRAALSEMVEYITHNRNVITEPIYPEVVHMFAVNMFRTLPPSSNPTGAEFDPEEDEPTLEAAWPHLQLVYEFFLRFLESPDFQPNIAKKYIDQKFVLQLLELFDSEDPRERDFLKTTLHRIYGKFLGLRAYIRKQINNIFYRFIYETEHHNGIAELLEILGSIINGFALPLKEEHKIFLLKVLLPLHKVKSLSVYHPQLAYCVVQFLEKDSTLTEPVVMALLKYWPKTHSPKEVMFLNELEEILDVIEPSEFVKIMEPLFRQLAKCVSSPHFQVAERALYYWNNEYIMSLISDNAAKILPIMFP

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	Human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(PAPCPAPCPAPCPTPTPGPAPCPTPAPGPGPGPTPG)-3') ;
Molecular weight formula_weight	15074.7 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	I,L

CCAGGAGAGAAATTTAGTACACAGATATCCACCCTAGTCAAGTGTGTCC

Entity 4 Entity 4 polymer

Description description	DNA (25-MER)
Molecular weight formula_weight	7614.9 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	J,M

ACTGTGTACTAAATTTCTCTCCTGG

Entity 5 Entity 5 polymer

Description description	;DNA (5'-D(PAPCPAPCPAPCPTPTPGPAPCPTPAPGPGPGPTPG)-3') ;
Molecular weight formula_weight	6199.0 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	K,N

GGACACACTTGACTAGGGTG

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	4

Entity 7 Entity 7 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	2

▼

7. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

Domain ID domain_id	6voyE00
Class class	1 — Mainly Alpha
Architecture architecture	25 — Alpha Horseshoe
Topology topology	10 — Leucine-rich Repeat Variant
Homologous superfamily homologous superfamily	10 — Leucine-rich Repeat Variant

Domain ID domain_id	6voyF00
Class class	1 — Mainly Alpha
Architecture architecture	25 — Alpha Horseshoe
Topology topology	10 — Leucine-rich Repeat Variant
Homologous superfamily homologous superfamily	10 — Leucine-rich Repeat Variant

▶

8. Citations (1)

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.70 Å
Resolution测定方法 resolution_method	—
颗粒数 num_particles	30434

fit	/app/data/saxs_computation/vo/6voy/6voy.fit
pddf	/app/data/pr_computation/vo/6voy/6voy.pr.out
profile	/app/data/saxs_computation/vo/6voy/6voy.dat

Cryo-EM structure of HTLV-1 instasome

1. Protein Identity and Related Structures Protein Identity & Related Structures

DNA-binding protein 7d

State in the Current Structure

Other States of the Same Protein in the Database

DNA-binding protein 7d

State in the Current Structure

Other States of the Same Protein in the Database

Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

冷冻电镜 EM 3D

6. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

7. Fold Classification (SCOP + CATH) 2 domains

CATH v4.4 (2 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)