5ejk

Crystal structure of the Rous sarcoma virus intasome

Method: X-RAY DIFFRACTION D_max: 154.1 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Gag-Pro-Pol polyprotein

Rous sarcoma virus (strain Prague C)

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–DNA Homooligomer Protein × 8 DNA 8 PDB declaration: hexadecameric（16） Consistent with all polymer counts	Chain A； UniProt 1281–1550 Chain B； UniProt 1281–1550 Chain C； UniProt 1281–1550 Chain D； UniProt 1281–1550 Chain E； UniProt 1281–1550 Chain F； UniProt 1281–1550 Chain G； UniProt 1281–1550 Chain H； UniProt 1281–1550	Fragment：UNP residues 573-842 Mutation：C23S, L112M, L135M, L162M, L163M, L188 M, L189M Non-standard monomer：Yes (specific site not provided by mmCIF)	RSV Integrase × 2 ;DNA (5'-D(APAPTPGPTPTPGPTPCPTPTPAPTPGPCPAPAPTPAPCPTPC)-3') ; × 2 ;DNA (5'-D(CPTPTPCPTPCPTPC)-3') ; × 2 ;DNA (5'-D(APGPTPGPTPCPTPT)-3') ; × 2 ZN ZINC ION × 8 W TUNGSTEN ION × 36	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION；293 K；Sodium formate	Resolution 3.80 Å R-free 0.294

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 5EJK	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
1A5V ASV INTEGRASE CORE DOMAIN WITH HIV-1 INTEGRASE INHIBITOR Y3 AND MN CATION Deposited 1998-02-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa） Fragment：CATALYTIC CORE DOMAIN	Not recorded	MN MANGANESE (II) ION × 2 Y3 4-ACETYLAMINO-5-HYDROXYNAPHTHALENE-2,7-DISULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；20% PEG 4000, 10% ISOPROPANOL, 0.1M NA HEPES, PH 7.5	Resolution 1.90 Å R-free 0.210
1A5V ASV INTEGRASE CORE DOMAIN WITH HIV-1 INTEGRASE INHIBITOR Y3 AND MN CATION Deposited 1998-02-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa） Fragment：CATALYTIC CORE DOMAIN	Not recorded	MN MANGANESE (II) ION × 2 Y3 4-ACETYLAMINO-5-HYDROXYNAPHTHALENE-2,7-DISULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；20% PEG 4000, 10% ISOPROPANOL, 0.1M NA HEPES, PH 7.5	Resolution 1.90 Å R-free 0.210
1A5W ASV INTEGRASE CORE DOMAIN WITH HIV-1 INTEGRASE INHIBITOR Y3 Deposited 1998-02-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa） Fragment：CATALYTIC CORE DOMAIN	Not recorded	Y3 4-ACETYLAMINO-5-HYDROXYNAPHTHALENE-2,7-DISULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；20% PEG 4000, 10% ISOPROPANOL, 0.1M NA CITRATE PH 5.6	Resolution 2.00 Å R-free 0.222
1A5X ASV INTEGRASE CORE DOMAIN WITH HIV-1 INTEGRASE INHIBITOR Y3 Deposited 1998-02-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa） Fragment：CATALYTIC CORE DOMAIN	Not recorded	Y3 4-ACETYLAMINO-5-HYDROXYNAPHTHALENE-2,7-DISULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；20% PEG 4000, 10% ISOPROPANOL, 0.1M HEPES, PH 7.5	Resolution 1.90 Å R-free 0.212
1ASU AVIAN SARCOMA VIRUS INTEGRASE CATALYTIC CORE DOMAIN CRYSTALLIZED FROM 2% PEG 400, 2M AMMONIUM SULFATE, HEPES PH 7.5 Deposited 1995-08-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa）	Mutation：INS(PRO 48, LEU 49, ARG 50, GLU 51, ASN 208, LEU 209)	EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5	Resolution 1.70 Å R-free 0.188
1ASV Avian sarcoma virus integrase catalytic core domain Deposited 1995-08-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa）	Mutation：INS(PRO 48, LEU 49, ARG 50, GLU 51, ASN 208, LEU 209) Non-standard monomer：Yes (specific site not provided by mmCIF)	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；pH 5.6	Resolution 2.20 Å R-free 0.234
1ASW AVIAN SARCOMA VIRUS INTEGRASE CATALYTIC CORE DOMAIN CRYSTALLIZED FROM 20% PEG 4000, 10% ISOPROPANOL, HEPES PH 7.5 USING SELENOMETHIONINE SUBSTITUTED PROTEIN; DATA COLLECTED AT-165 DEGREES C Deposited 1995-08-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa）	Mutation：INS(PRO 48, LEU 49, ARG 50, GLU 51, ASN 208, LEU 209) Non-standard monomer：Yes (specific site not provided by mmCIF)	EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2 IPA ISOPROPYL ALCOHOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5	Resolution 1.80 Å R-free 0.208
1C0M CRYSTAL STRUCTURE OF RSV TWO-DOMAIN INTEGRASE Deposited 1999-07-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 621–858（238 aa） Fragment：RESIDUES 49-286 Chain B 621–858（238 aa） Fragment：RESIDUES 49-286	Mutation：F199K Mutation：F199K	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions HANGING DROP VAPOR DIFFUSION METHOD；pH 7；277 K；PLATE-SHAPED CRYSTALS WERE INFREQUENTLY GROWN BY HANGING DROP VAPOR DIFFUSION METHOD. RESERVOIR SOLUTION CONTAINED 0.050M KCL, 0.01M MGCL2, 0.05M SODIUM CACODYLATE, PH 7.0, 10% PEG 3350, and 20% (V/V) ETHYLENE GLYCOL. THE DROP CONTAINED 1:1 MIXTURE OF RESERVOIR SOLUTION AND PROTEIN (10-15 MG/ML), HANGING DROP VAPOR DIFFUSION METHOD, temperature 277K	Resolution 2.53 Å R-free 0.279
1C0M CRYSTAL STRUCTURE OF RSV TWO-DOMAIN INTEGRASE Deposited 1999-07-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain C 621–858（238 aa） Fragment：RESIDUES 49-286 Chain D 621–858（238 aa） Fragment：RESIDUES 49-286	Mutation：F199K Mutation：F199K	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions HANGING DROP VAPOR DIFFUSION METHOD；pH 7；277 K；PLATE-SHAPED CRYSTALS WERE INFREQUENTLY GROWN BY HANGING DROP VAPOR DIFFUSION METHOD. RESERVOIR SOLUTION CONTAINED 0.050M KCL, 0.01M MGCL2, 0.05M SODIUM CACODYLATE, PH 7.0, 10% PEG 3350, and 20% (V/V) ETHYLENE GLYCOL. THE DROP CONTAINED 1:1 MIXTURE OF RESERVOIR SOLUTION AND PROTEIN (10-15 MG/ML), HANGING DROP VAPOR DIFFUSION METHOD, temperature 277K	Resolution 2.53 Å R-free 0.279
1C1A CRYSTAL STRUCTURE OF RSV TWO-DOMAIN INTEGRASE Deposited 1999-07-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 621–858（238 aa） Fragment：RESIDUES 49-286 Chain B 621–858（238 aa） Fragment：RESIDUES 49-286	Mutation：F199K Mutation：F199K	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions ROD-SHAPED CRYSTALS WERE GROWN BY SITTING DROP VAPOR DIFFUSION METHOD. RESERVOIR SOLUTION CONTAINED 0.050M KCL, 0.01M MGCL2, 0.1M SODIUM CACODYLATE, 0.02M IMIDAZOLE, PH 7.2, 10% PEG3350, AND 20% (V/V) ETHYLENE GLYCOL. THE DROP CONTAINED 1:1 MIXTURE OF RESERVOIR SOLUTION AND PROTEIN (10-15 MG/ML)	Resolution 3.10 Å R-free 0.337
1CXQ ATOMIC RESOLUTION ASV INTEGRASE CORE DOMAIN FROM AMMONIUM SULFATE Deposited 1999-08-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa） Fragment：CATALYTIC CORE DOMAIN	Mutation：INS(P48, L49, R50, E51, N208, L209)	EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2 GOL GLYCEROL × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；277 K；2% Peg 400, 2M Ammonium Sulfate, HEPES pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 277.0K	Resolution 1.02 Å R-free 0.157
1CXU 1.42A RESOLUTION ASV INTEGRASE CORE DOMAIN FROM CITRATE Deposited 1999-08-30	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa） Fragment：CATALYTIC CORE DOMAIN	Mutation：INS(P48, L49, R50, E51, N208, L209)	CIT CITRIC ACID × 2 GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；277 K；20% PEG 4000, 10% ISOPROPANOL, 100 MM CITRATE, PH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.42 Å R-free 0.221
1CZ9 ATOMIC RESOLUTION ASV INTEGRASE CORE DOMAIN (D64N) FROM CITRATE Deposited 1999-09-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa） Fragment：CATALYTIC CORE DOMAIN	Mutation：D64N, INS(P48, L49, R50, E51, N208, L209)	SO4 SULFATE ION × 2 CIT CITRIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 6.2；277 K；20% PEG 4000, 10% ISOPROPANOL, 100 MM CITRATE PH 6.2, VAPOR DIFFUSION, HANGING DROP, temperature 277.0K	Resolution 1.20 Å R-free 0.150
1CZB ATOMIC RESOLUTION ASV INTEGRASE CORE DOMAIN FROM HEPES Deposited 1999-09-01	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 624–779（156 aa） Fragment：CATALYTIC CORE DOMAIN	Mutation：INS(P48, L49, R50, E51, N208, L209)	EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7.5；277 K；20% PEG 4000, 10% ISOPROPANOL, 100 mM HEPES pH 7.5, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.06 Å R-free 0.164
1VSD ASV INTEGRASE CORE DOMAIN WITH MG(II) COFACTOR AND HEPES LIGAND, HIGH MG CONCENTRATION FORM Deposited 1995-11-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 616–771（156 aa） Fragment：CATALYTIC CORE DOMAIN, RESIDUES 1 - 4, 52 - 209	Non-standard monomer：Yes (specific site not provided by mmCIF)	MG MAGNESIUM ION × 2 EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5 THE PROTEIN WAS CRYSTALLIZED FROM 20% PEG 4000, 10% ISOPROPANOL, 100 MILLI-MOLAR HEPES PH 7.5. CRYSTALS WERE THEN SOAKED IN 500 MILLI-MOLAR MGCL2.	Resolution 1.70 Å R-free 0.191
1VSE ASV INTEGRASE CORE DOMAIN WITH MG(II) COFACTOR AND HEPES LIGAND, LOW MG CONCENTRATION FORM Deposited 1995-11-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 626–771（146 aa） Fragment：CATALYTIC CORE DOMAIN, RESIDUES 1 - 4, 52 - 209	Not recorded	EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5 THE PROTEIN WAS CRYSTALLIZED FROM 20% PEG 4000, 10% ISOPROPANOL, 100 MILLIMOLAR HEPES PH 7.5. CRYSTALS WERE THEN SOAKED IN 20 MILLIMOLAR MGCL2.	Resolution 2.20 Å R-free 0.201
1VSF ASV INTEGRASE CORE DOMAIN WITH MN(II) COFACTOR AND HEPES LIGAND, HIGH MG CONCENTRATION FORM Deposited 1995-11-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 626–771（146 aa） Fragment：CATALYTIC CORE DOMAIN, RESIDUES 1 - 4, 52 - 209	Not recorded	MN MANGANESE (II) ION × 2 EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；pH 7.5 THE PROTEIN WAS CRYSTALLIZED FROM 20% PEG 4000, 10% ISOPROPANOL, 100 MILLIMOLAR HEPES PH 7.5. CRYSTALS WERE THEN SOAKED IN 10 MILLIMOLAR MNCL2.	Resolution 2.05 Å R-free 0.189
1VSH ASV INTEGRASE CORE DOMAIN WITH ZN(II) COFACTORS Deposited 1997-03-04	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 626–771（146 aa） Fragment：CATALYTIC CORE DOMAIN, RESIDUES 1 - 4, 52 - 209	Non-standard monomer：Yes (specific site not provided by mmCIF)	ZN ZINC ION × 8 EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；PROTEIN WAS CRYSTALLIZED FROM 20% PEG 4000, 10% ISOPROPANOL, 100 MM HEPES, PH 7.5, THEN SOAKED IN 100 MM ZNCL2.	Resolution 1.95 Å
1VSI ASV INTEGRASE CORE DOMAIN WITH CA(II) COFACTOR Deposited 1997-03-04	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 626–771（146 aa） Fragment：CATALYTIC CORE DOMAIN, RESIDUES 1 - 4, 52 - 209	Non-standard monomer：Yes (specific site not provided by mmCIF)	CA CALCIUM ION × 2 EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；PROTEIN WAS CRYSTALLIZED FROM 20% PEG 4000, 10% ISOPROPANOL, 100 MM HEPES, PH 7.5, THEN SOAKED IN 100 MM CACL2.	Resolution 2.20 Å
1VSJ ASV INTEGRASE CORE DOMAIN WITH CD(II) COFACTORS Deposited 1997-03-04	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 626–771（146 aa） Fragment：CATALYTIC CORE DOMAIN, RESIDUES 1 - 4, 52 - 209	Non-standard monomer：Yes (specific site not provided by mmCIF)	CD CADMIUM ION × 4 EPE 4-(2-HYDROXYETHYL)-1-PIPERAZINE ETHANESULFONIC ACID × 2	X-RAY DIFFRACTION X-ray crystallization conditions pH 7.5；PROTEIN WAS CRYSTALLIZED FROM 20% PEG 4000, N10% ISOPROPANOL, 100 MM HEPES, PH 7.5, THEN SOAKED IN 100 MM CDCL2.	Resolution 2.10 Å
1VSK ASV INTEGRASE CORE DOMAIN D64N MUTATION IN CITRATE BUFFER PH 6.0 Deposited 1998-09-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 626–771（146 aa） Fragment：CATALYTIC CORE DOMAIN	Mutation：D64N	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；20% PEG 4000, 10% ISOPROPANOL, 0.1M NA CITRATE PH 5.6	Resolution 2.20 Å R-free 0.249
1VSL ASV INTEGRASE CORE DOMAIN D64N MUTATION WITH ZINC CATION Deposited 1998-09-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 626–771（146 aa） Fragment：CATALYTIC CORE DOMAIN	Mutation：D64N	ZN ZINC ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；20% PEG 4000, 10% ISOPROPANOL, 0.1M NA CITRATE PH 5.6	Resolution 2.20 Å R-free 0.244
1VSM ASV INTEGRASE CORE DOMAIN IN CITRATE BUFFER PH 5.0 Deposited 1998-09-18	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 626–771（146 aa） Fragment：CATALYTIC CORE DOMAIN	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 5.6；20% PEG 4000, 10% ISOPROPANOL, 0.1M NA CITRATE PH 5.0, pH 5.6	Resolution 2.15 Å R-free 0.238
3TIR Pseudo-atomic model of the Rous Sarcoma Virus capsid hexamer Deposited 2011-08-21	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 6 PDB declaration: hexameric	Chain A 240–465（226 aa） Fragment：UNP resides 240-465	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions pH 10.3；291.15 K；2-7 %(w/v) PEG 8000 0.2M CAPS/KOH, pH 10.3, VAPOR DIFFUSION, SITTING DROP, temperature 291.15K	Resolution 4.10 Å R-free 0.391
4FW1 Crystal structure of two-domain RSV INTEGRASE covalently linked with DNA Deposited 2012-06-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1329–1550（222 aa） Fragment：UNP residues 1329-1580 Chain B 1329–1550（222 aa） Fragment：UNP residues 1329-1580	Mutation：S124D, C125A, E157C, R166K, F199K Mutation：S124D, C125A, E157C, R166K, F199K	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.5；293 K；5% Ethanol, 10% PEG4,000, 100mM Tris-HCl, pH 8.5, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 1.86 Å R-free 0.222
4FW2 Crystal structure of RSV three-domain integrase with disordered N-terminal domain Deposited 2012-06-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 1281–1550（270 aa） Fragment：UNP residues 1281-1550 Chain B 1281–1550（270 aa） Fragment：UNP residues 1281-1550	Mutation：C23S, R166K, F199K Mutation：C23S, R166K, F199K	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 7；293 K；20% ethanol, 100 mM imidazole-HCl, and 5% PEG4000, pH 7.0, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.65 Å R-free 0.244
5KZ9 Crystal structure of the Rous sarcoma virus matrix protein. Deposited 2016-07-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–155（155 aa） Fragment：UNP residues 1-155	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 10.3；293 K；2.60 M Ammonium formate, 0.20 M Beta-Alanine/KOH pH 10.3	Resolution 2.85 Å R-free 0.239
5KZ9 Crystal structure of the Rous sarcoma virus matrix protein. Deposited 2016-07-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 1–155（155 aa） Fragment：UNP residues 1-155	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 10.3；293 K；2.60 M Ammonium formate, 0.20 M Beta-Alanine/KOH pH 10.3	Resolution 2.85 Å R-free 0.239
5KZA Crystal structure of the Rous sarcoma virus matrix protein (aa 2-102). Space group I41 Deposited 2016-07-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 2–102（101 aa） Fragment：UNP residues 2-102	Not recorded	NO3 NITRATE ION × 2 EDO 1,2-ETHANEDIOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.5；291.15 K；18%(w/v) PEG 8000, 0.2 M Succinic acid/KOH pH 5.5, 1.0 M Ammonium nitrate	Resolution 1.86 Å R-free 0.210
5KZA Crystal structure of the Rous sarcoma virus matrix protein (aa 2-102). Space group I41 Deposited 2016-07-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 2 PDB declaration: dimeric	Chain A 2–102（101 aa） Fragment：UNP residues 2-102	Not recorded	NO3 NITRATE ION × 4 EDO 1,2-ETHANEDIOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 5.5；291.15 K；18%(w/v) PEG 8000, 0.2 M Succinic acid/KOH pH 5.5, 1.0 M Ammonium nitrate	Resolution 1.86 Å R-free 0.210
5KZB Crystal structure of the Rous sarcoma virus matrix protein (aa 2-102). Space group I4122 Deposited 2016-07-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 2–102（101 aa） Fragment：UNP residues 2-102	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 9.1；291.15 K；0.6 M Malonic acid /KOH pH 9.1, 0.1 M Boric acid /KOH pH 9.1	Resolution 3.20 Å R-free 0.249
5KZB Crystal structure of the Rous sarcoma virus matrix protein (aa 2-102). Space group I4122 Deposited 2016-07-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein homooligomer Homooligomer；Protein × 4 PDB declaration: tetrameric	Chain A 2–102（101 aa） Fragment：UNP residues 2-102	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 9.1；291.15 K；0.6 M Malonic acid /KOH pH 9.1, 0.1 M Boric acid /KOH pH 9.1	Resolution 3.20 Å R-free 0.249
6CCJ NMR structure of the Rous sarcoma virus matrix protein (M domain) Deposited 2018-02-07	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 2–87（86 aa）	Mutation：M1S	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6；305 K；Ionic strength (raw mmCIF value) 0.1；Pressure 1 NMR sample composition 0.5 mM [U-95% 13C; U-95% 15N] RSV MA, 50 mM sodium phosphate, 50 mM sodium chloride, 2 mM TCEP, 95% H2O/5% D2O \| 95% H2O/5% D2O NMR sample composition .5 mM [U-95% 15N] Matrix protein, 50 mM sodium phosphate, 50 mM sodium chloride, 2 M TCEP, 95% H2O/5% D2O \| 95% H2O/5% D2O NMR sample composition 0.5 mM [U-95% 13C] Matrix protein, 50 mM sodium phosphate, 50 mM sodium chloride, 2 mM TCEP, 100% D2O \| 100% D2O	Resolution not provided
6CE5 NMR structure of the Rous sarcoma virus matrix protein (M-domain) in the presence of myo-inositol hexakisphosphate Deposited 2018-02-11	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–87（87 aa）	Mutation：M1S	No recorded non-water small molecule	SOLUTION NMR NMR measurement conditions pH 6；305 K；Ionic strength (raw mmCIF value) 0.05；Pressure 1 NMR sample composition 0.5 mM [U-95% 15N] Matrix protein, 50 mM sodium phosphate, 2 mM tcep, 2 mM IP6, 95% H2O/5% D2O \| 95% H2O/5% D2O NMR sample composition 0.5 mM [U-95% 13C; U-95% 15N] Matrix protein, 50 mM sodium phosphate, 2 mM tcep, 2 mM IP6, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
6CUS HADDOCK structure of the Rous sarcoma virus matrix protein (M-domain) in complex with myo-inositol hexakisphosphate Deposited 2018-03-26	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–87（87 aa）	Mutation：M1S	IHP INOSITOL HEXAKISPHOSPHATE × 1	SOLUTION NMR NMR measurement conditions pH 6；305 K；Ionic strength (raw mmCIF value) 100；Pressure 1 NMR sample composition 500 uM [U-98% 15N] Matrix protein, 50 mM sodium phosphate, 2 mM TCEP, 2 mM INOSITOL HEXAKISPHOSPHATE, 95% H2O/5% D2O \| 95% H2O/5% D2O NMR sample composition 0.5 mM [U-98% 13C] Matrix protein, 50 mM sodium phosphate, 2 mM TCEP, 2 mM INOSITOL HEXAKISPHOSPHATE, 100% D2O \| 100% D2O	Resolution not provided
6CV8 HADDOCK structure of the Rous sarcoma virus matrix protein (M-domain) in complex with inositol 1,4,5-trisphosphate Deposited 2018-03-27	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–87（87 aa）	Mutation：M1S	I3P D-MYO-INOSITOL-1,4,5-TRIPHOSPHATE × 1	SOLUTION NMR NMR measurement conditions pH 6；305 K；Ionic strength (raw mmCIF value) 100；Pressure 1 NMR sample composition 100 uM [U-98% 15N] Matrix protein, 50 mM sodium phosphate, 2 mM TCEP, 1.6 mM D-MYO-INOSITOL-1,4,5-TRIPHOSPHATE, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
6CW4 HADDOCK structure of the Rous sarcoma virus matrix protein (M-domain) in complex with inositol 1,3,5-trisphosphate Deposited 2018-03-29	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 1–87（87 aa） Fragment：residues 1-87	Mutation：M1S	FGV (1R,2S,3r,4R,5S,6s)-2,4,6-trihydroxycyclohexane-1,3,5-triyl tris[dihydrogen (phosphate)] × 1	SOLUTION NMR NMR measurement conditions pH 6；305 K；Ionic strength (raw mmCIF value) 100；Pressure 1 NMR sample composition 100 uM [U-98% 15N] Matrix protein, 50 mM sodium phosphate, 2 mM TCEP, 1.6 mM IP3, 95% H2O/5% D2O \| 95% H2O/5% D2O	Resolution not provided
7JN3 Cryo-EM structure of Rous sarcoma virus cleaved synaptic complex (CSC) with HIV-1 integrase strand transfer inhibitor MK-2048 Deposited 2020-08-03	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 8 PDB declaration: dodecameric	Chain A 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain B 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain C 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain D 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain E 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain F 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain G 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain H 1281–1558（278 aa） Fragment：UNP residues 1281-1558	Not recorded	ZN ZINC ION × 2 ZZX (6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino[1',2':1,5]pyrrolo[2,3-d]pyridazine-4-carboxamide × 2 MG MAGNESIUM ION × 4	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.21 Å
7KU7 Cryo-EM structure of Rous sarcoma virus cleaved synaptic complex (CSC) with HIV-1 integrase strand transfer inhibitor MK-2048. Cluster identified by 3-dimensional variability analysis in cryoSPARC. Deposited 2020-11-24	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 8 PDB declaration: dodecameric	Chain A 1281–1558（278 aa） Chain B 1281–1558（278 aa） Chain C 1281–1558（278 aa） Chain D 1281–1558（278 aa） Chain E 1281–1558（278 aa） Chain F 1281–1558（278 aa） Chain G 1281–1558（278 aa） Chain H 1281–1558（278 aa）	Not recorded	ZN ZINC ION × 2 MG MAGNESIUM ION × 4 ZZX (6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino[1',2':1,5]pyrrolo[2,3-d]pyridazine-4-carboxamide × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å
7KUI Cryo-EM structure of Rous sarcoma virus cleaved synaptic complex (CSC) with HIV-1 integrase strand transfer inhibitor MK-2048. CIC region of a cluster identified by 3-dimensional variability analysis in cryoSPARC. Deposited 2020-11-25	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 8 PDB declaration: dodecameric	Chain A 1281–1558（278 aa） Chain B 1281–1558（278 aa） Chain C 1281–1558（278 aa） Chain D 1281–1558（278 aa） Chain E 1281–1558（278 aa） Chain F 1281–1558（278 aa） Chain G 1281–1558（278 aa） Chain H 1281–1558（278 aa）	Not recorded	ZN ZINC ION × 2 ZZX (6S)-2-(3-chloro-4-fluorobenzyl)-8-ethyl-10-hydroxy-N,6-dimethyl-1,9-dioxo-1,2,6,7,8,9-hexahydropyrazino[1',2':1,5]pyrrolo[2,3-d]pyridazine-4-carboxamide × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.40 Å
8E14 Cryo-EM structure of Rous sarcoma virus strand transfer complex Deposited 2022-08-09	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–DNA Homooligomer；Protein × 8 PDB declaration: tetradecameric	Chain A 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain B 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain C 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain D 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain E 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain F 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain G 1281–1558（278 aa） Fragment：UNP residues 1281-1558 Chain H 1281–1558（278 aa） Fragment：UNP residues 1281-1558	Not recorded	ZN ZINC ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.36 Å

36 other PDB entries and 41 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	POL_RSVP
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–270； UniProt 1281–1550 Author chain B； PDBConstruct 1–270； UniProt 1281–1550 Author chain C； PDBConstruct 1–270； UniProt 1281–1550 Author chain D； PDBConstruct 1–270； UniProt 1281–1550 Author chain E； PDBConstruct 1–270； UniProt 1281–1550 Author chain F； PDBConstruct 1–270； UniProt 1281–1550 Author chain G； PDBConstruct 1–270； UniProt 1281–1550 Author chain H； PDBConstruct 1–270； UniProt 1281–1550

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5ejk
Deposition date deposition_date	2015-11-02
Structure title title	Crystal structure of the Rous sarcoma virus intasome
Keywords keywords	RSV, integrase, intasome, Transferase-DNA complex; Transferase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	47.42 Å
Radius of gyration Rg (electron density) rg_electron	47.22 Å
Forward intensity I(0) i0	1703550000.00
Molecular weight molecular_weight	288810.0 kDa
Excluded volume excluded_volume	336020 Å³
Envelope volume envelope_volume	505460 Å³
Hydration-shell volume shell_volume	88395 Å³
Envelope diameter envelope_diameter	166.3 Å
Shell Rg shell_rg	52.28 Å
Envelope Rg envelope_rg	46.33 Å
Shape Rg shape_rg	47.02 Å
Total Rg total_rg	47.90 Å
Total atoms total_atoms	19335
Residues n_residues	2128
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	154.1 Å
Rg (real space) rg_real	47.27 Å
Rg uncertainty (real space) rg_real_error	0.95 Å
I(0) (real space) i0_real	1.7040e+09
I(0) uncertainty (real space) i0_real_error	3.3790e+07
Rg (reciprocal space) rg_reciprocal	47.42 Å
I(0) (reciprocal space) i0_reciprocal	1704000000.0000
Solution quality estimate total_estimate	0.8795
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	60.7 Å
Skewness Skewness skewness	0.259
Kurtosis Kurtosis kurtosis	-0.303
Angular range angular_range	— – 0.1650 Å⁻¹
Current regularization parameter α current_alpha	0.0001
Highest regularization parameter α highest_alpha	118300000.0000
Real-space data points n_real_points	34
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.889; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.983; Smooth: 0.781

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	Gag-Pro-Pol polyprotein
Molecular weight formula_weight	30574.5 kDa
EC 编号 ec_number	3.4.23.-,2.7.7.49,2.7.7.7,3.1.26.4,2.7.7.-,3.1.-.-
Mutation mutation	C23S, L112M, L135M, L162M, L163M, L188 M, L189M
Source method src_method	man
Copy count entity_count	8

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F,G,H
Atom count atom_count	19335

PLREAKDLHTALHIGPRALSKASNISMQQAREVVQTCPHCNSAPALEAGVNPRGLGPLQIWQTDFTLEPRMAPRSWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVMGRPKAIKTDNGSCFTSKSTREWMARWGIAHTTGIPGNSQGQAMVERANRMMKDKIRVLAEGDGFMKRIPTSKQGEMMAKAMYALNHFERGENTKTPIQKHWRPTVLTEGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDIT

来源 Source

来源生物 organism	Rous sarcoma virus (strain Prague C)
通用名 common_name	RSV-PrC
NCBI Class编号 ncbi_taxonomy_id	11888
宿主生物 host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RSV Integrase
Molecular weight formula_weight	13047.5 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	I,L

GAGTATTGCATAAGACAACAGTGCACGAAAGAAGAAGACACT

来源 Source

来源生物 organism	Rous sarcoma virus (strain Schmidt-Ruppin E)
NCBI Class编号 ncbi_taxonomy_id	270623
宿主生物 host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(APAPTPGPTPTPGPTPCPTPTPAPTPGPCPAPAPTPAPCPTPC)-3') ;
Molecular weight formula_weight	6716.4 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	J,M

AATGTTGTCTTATGCAATACTC

Entity 4 Entity 4 polymer

Description description	;DNA (5'-D(CPTPTPCPTPCPTPC)-3') ;
Molecular weight formula_weight	2343.6 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	K,N

CTTCTTTC

Entity 5 Entity 5 polymer

Description description	;DNA (5'-D(APGPTPGPTPCPTPT)-3') ;
Molecular weight formula_weight	2432.6 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	k,n

AGTGTCTT

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	8

Entity 7 Entity 7 non-polymer

Description description	TUNGSTEN ION
Molecular weight formula_weight	183.8 kDa
Source method src_method	syn
Copy count entity_count	36

▼

7. Fold Classification (SCOP + CATH) 15 domains

CATH v4.4 (15 domains)

Domain ID domain_id	5ejkA01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkA02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkB01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkB02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkC01
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkD01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkD02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkE01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkE02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkF01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkF02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkG01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkG02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkH01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkH02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

▶

8. Citations (1)

▶

Unit-cell length a length_a	124.936 Å
Unit-cell length b length_b	157.854 Å
Unit-cell length c length_c	126.583 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	110.94 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	3.800 Å
Low-resolution limit resolution_low	49.215 Å
R factor r_factor	0.2557
R_work r_work	0.2537
R_free r_free	0.2945

fit	/app/data/saxs_computation/ej/5ejk/5ejk.fit
pddf	/app/data/pr_computation/ej/5ejk/5ejk.pr.out
profile	/app/data/saxs_computation/ej/5ejk/5ejk.dat

Crystal structure of the Rous sarcoma virus intasome

1. Protein Identity and Related Structures Protein Identity & Related Structures

Gag-Pro-Pol polyprotein

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

来源 Source

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

7. Fold Classification (SCOP + CATH) 15 domains

CATH v4.4 (15 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)