5ejk

Crystal structure of the Rous sarcoma virus intasome

Method: X-RAY DIFFRACTION

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Gag-Pro-Pol polyprotein

Rous sarcoma virus (strain Prague C)

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Protein–DNA	Homooligomer	Protein 8 DNA 8	RSV Integrase × 2 ;DNA (5'-D(APAPTPGPTPTPGPTPCPTPTPAPTPGPCPAPAPTPAPCPTPC)-3') ; × 2 ;DNA (5'-D(CPTPTPCPTPCPTPC)-3') ; × 2 ;DNA (5'-D(APGPTPGPTPCPTPT)-3') ; × 2 ZINC ION × 8 TUNGSTEN ION × 36	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	POL_RSVP
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 1–270； UniProt 1281–1550 Author chain B； PDBConstruct 1–270； UniProt 1281–1550 Author chain C； PDBConstruct 1–270； UniProt 1281–1550 Author chain D； PDBConstruct 1–270； UniProt 1281–1550 Author chain E； PDBConstruct 1–270； UniProt 1281–1550 Author chain F； PDBConstruct 1–270； UniProt 1281–1550 Author chain G； PDBConstruct 1–270； UniProt 1281–1550 Author chain H； PDBConstruct 1–270； UniProt 1281–1550

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5ejk
Deposition date deposition_date	2015-11-02
Structure title title	Crystal structure of the Rous sarcoma virus intasome
Keywords keywords	RSV, integrase, intasome, Transferase-DNA complex; Transferase/DNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

5ejk__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

5ejk__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

5ejk__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	47.42 Å
Rg (electron density)	47.22 Å
Total Rg	47.90 Å
Atom count	19335
Residues	2128
Excluded volume	336020 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`5ejk__assembly_1__model_1`	hexadecameric （16）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Description description	Gag-Pro-Pol polyprotein
Molecular weight formula_weight	30574.5 kDa
EC 编号 ec_number	3.4.23.-,2.7.7.49,2.7.7.7,3.1.26.4,2.7.7.-,3.1.-.-
Mutation mutation	C23S, L112M, L135M, L162M, L163M, L188 M, L189M
Source method src_method	man
Copy count entity_count	8

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A,B,C,D,E,F,G,H
Atom count atom_count	19335

PLREAKDLHTALHIGPRALSKASNISMQQAREVVQTCPHCNSAPALEAGVNPRGLGPLQIWQTDFTLEPRMAPRSWLAVTVDTASSAIVVTQHGRVTSVAVQHHWATAIAVMGRPKAIKTDNGSCFTSKSTREWMARWGIAHTTGIPGNSQGQAMVERANRMMKDKIRVLAEGDGFMKRIPTSKQGEMMAKAMYALNHFERGENTKTPIQKHWRPTVLTEGPPVKIRIETGEWEKGWNVLVWGRGYAAVKNRDTDKVIWVPSRKVKPDIT

Source Source

Source organism organism	Rous sarcoma virus (strain Prague C)
Common name common_name	RSV-PrC
NCBI taxonomy ID ncbi_taxonomy_id	11888
Host organism host_organism	Escherichia coli

Entity 2 Entity 2 polymer

Description description	RSV Integrase
Molecular weight formula_weight	13047.5 kDa
Source method src_method	man
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	I,L

GAGTATTGCATAAGACAACAGTGCACGAAAGAAGAAGACACT

Source Source

Source organism organism	Rous sarcoma virus (strain Schmidt-Ruppin E)
NCBI taxonomy ID ncbi_taxonomy_id	270623
Host organism host_organism	Escherichia coli

Entity 3 Entity 3 polymer

Description description	;DNA (5'-D(APAPTPGPTPTPGPTPCPTPTPAPTPGPCPAPAPTPAPCPTPC)-3') ;
Molecular weight formula_weight	6716.4 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	J,M

AATGTTGTCTTATGCAATACTC

Entity 4 Entity 4 polymer

Description description	;DNA (5'-D(CPTPTPCPTPCPTPC)-3') ;
Molecular weight formula_weight	2343.6 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	K,N

CTTCTTTC

Entity 5 Entity 5 polymer

Description description	;DNA (5'-D(APGPTPGPTPCPTPT)-3') ;
Molecular weight formula_weight	2432.6 kDa
Source method src_method	syn
Copy count entity_count	2

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	k,n

AGTGTCTT

Entity 6 Entity 6 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	8

Entity 7 Entity 7 non-polymer

Description description	TUNGSTEN ION
Molecular weight formula_weight	183.8 kDa
Source method src_method	syn
Copy count entity_count	36

▼

6. Fold Classification (SCOP + CATH) 15 domains

CATH v4.4 (15 domains)

Domain ID domain_id	5ejkA01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkA02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkB01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkB02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkC01
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkD01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkD02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkE01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkE02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkF01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkF02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkG01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkG02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

Domain ID domain_id	5ejkH01
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

Domain ID domain_id	5ejkH02
Class class	2 — Mainly Beta
Architecture architecture	30 — Roll
Topology topology	30 — SH3 type barrels.
Homologous superfamily homologous superfamily	10 — Integrase, C-terminal domain superfamily, retroviral

▶

Unit-cell length a length_a	124.936 Å
Unit-cell length b length_b	157.854 Å
Unit-cell length c length_c	126.583 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	110.94 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	16

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	3.800 Å
Low-resolution limit resolution_low	49.215 Å
R factor r_factor	0.2557
R_work r_work	0.2537
R_free r_free	0.2945

Crystal structure of the Rous sarcoma virus intasome

1. Protein Identity and Related Structures Protein Identity & Related Structures

Gag-Pro-Pol polyprotein

State in the Current Structure

Other States of the Same Protein in the Database

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5ejk__assembly_1__model_1

5ejk__assembly_1__model_1 | I(q)

5ejk__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

6. Fold Classification (SCOP + CATH) 15 domains

CATH v4.4 (15 domains)

7. Citations (1)

Crystal structure of the Rous sarcoma virus intasome

1. Protein Identity and Related Structures Protein Identity & Related Structures

Gag-Pro-Pol polyprotein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

5ejk__assembly_1__model_1

5ejk__assembly_1__model_1 | I(q)

5ejk__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

5. Entities and Polymers Entities & Polymers (7)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Source Source

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 non-polymer

Entity 7 Entity 7 non-polymer

6. Fold Classification (SCOP + CATH) 15 domains

CATH v4.4 (15 domains)

7. Citations (1)