9hdr

Human LINE-1 ORF2p target-primed reverse transcription complex with EN domain resolved

Method: ELECTRON MICROSCOPY

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

LINE-1 retrotransposable element ORF2 protein

Homo sapiens

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 DNA 5 RNA 1	Target DNA strand 1 × 1 Target DNA strand 2 × 1 Template P(A)30 RNA × 1 Target DNA strand 3 × 1 Target DNA strand 4 × 1 Unassigned Nucleic Acid × 1 MAGNESIUM ION × 1 ZINC ION × 1 2',3'-DIDEOXY-THYMIDINE-5'-TRIPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	LORF2_HUMAN
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 523–1797； UniProt 1–1275

LINE-1 retrotransposable element ORF2 protein

Homo sapiens

UniProt P0AEX9

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 DNA 5 RNA 1	Target DNA strand 1 × 1 Target DNA strand 2 × 1 Template P(A)30 RNA × 1 Target DNA strand 3 × 1 Target DNA strand 4 × 1 Unassigned Nucleic Acid × 1 MAGNESIUM ION × 1 ZINC ION × 1 2',3'-DIDEOXY-THYMIDINE-5'-TRIPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	MALE_ECOLI
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 46–409； UniProt 29–392

LINE-1 retrotransposable element ORF2 protein

Homo sapiens

UniProt Q12306

State in the Current Structure

Assembly	Physical composition	Protein state	Molecular copy count	Associated components	Data consistency
1	Insufficient information	Monomer	Protein 1 DNA 5 RNA 1	Target DNA strand 1 × 1 Target DNA strand 2 × 1 Template P(A)30 RNA × 1 Target DNA strand 3 × 1 Target DNA strand 4 × 1 Unassigned Nucleic Acid × 1 MAGNESIUM ION × 1 ZINC ION × 1 2',3'-DIDEOXY-THYMIDINE-5'-TRIPHOSPHATE × 1	Consistent with all polymers

Other States of the Same Protein in the Database

View Construct and Data Evidence

UniProt name	SMT3_YEAST
Isoform	—
PDB entities	1
Chains and sequence ranges	Author chain A； PDBConstruct 426–522； UniProt 2–98

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	9hdr
Deposition date deposition_date	2024-11-12
Structure title title	Human LINE-1 ORF2p target-primed reverse transcription complex with EN domain resolved
Keywords keywords	LINE-1, L1, ORF2p, Reverse transcriptase, endonuclease, DNA, RNA, RNA BINDING PROTEIN; RNA BINDING PROTEIN
Experimental Method method	ELECTRON MICROSCOPY

▼

3. Official assembly/model SAXS Official SAXS Profiles

This page reads only the latest assembly calculations. Every curve maps to an explicit PDB entry, official biological assembly and coordinate model.

9hdr__assembly_1__model_1

Assembly 1 · Model 1 · CRYSOL 4.1.3-1-20251215 (887e7ef)

Download this curve (.dat)

9hdr__assembly_1__model_1 | I(q)

100 plotted points; both axes use logarithmic scales.

9hdr__assembly_1__model_1 | P(r) · Pending

P(r) will be calculated and displayed separately for the same assembly/model.

Rg（Guinier）	39.98 Å
Rg (electron density)	39.54 Å
Total Rg	39.95 Å
Atom count	12202
Residues	1348
Excluded volume	214360 Å³
Maximum q	0.500 Å⁻¹

Assembly	Model	Structure unit	Oligomeric description	Status	CRYSOL	Actions
1	1	`9hdr__assembly_1__model_1`	heptameric （7）	Success	4.1.3-1-20251215 (887e7ef)	View Download

▶

4. Crystallography and Experiment 4. Crystallography & Experiment

▶

5. Entities and Polymers Entities & Polymers (10)

Entity 1 Entity 1 polymer

Description description	LINE-1 retrotransposable element ORF2 protein
Molecular weight formula_weight	206717.6 kDa
EC 编号 ec_number	2.7.7.49,3.1.21.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A
Atom count atom_count	12202

MVHHHHHHHHGGSAWSHPQFEKGGGSGGGSGGSAWSHPQFEKGGSEEGKLVIWINGDKGYNGLAEVGKKFEKDTGIKVTVEHPDKLEEKFPQVAATGDGPDIIFWAHDRFGGYAQSGLLAEITPDKAFQDKLYPFTWDAVRYNGKLIAYPIAVEALSLIYNKDLLPNPPKTWEEIPALDKELKAKGKSALMFNLQEPYFTWPLIAADGGYAFKYENGKYDIKDVGVDNAGAKAGLTFLVDLIKNKHMNADTDYSIAEAAFNKGETAMTINGPWAWSNIDTSKVNYGVTVLPTFKGQPSKPFVGVLSAGINAASPNKELAKEFLENYLLTDEGLEAVNKDKPLGAVALKSYEEELVKDPRIAATMENAQKGEIMPNIPQMSAFWYAVRTAVINAASGRQTVDEALKDAQTNSSSNNNNNNNNNNLGSDSEVNQEAKPEVKPEVKPETHINLKVSDGSSEIFFKIKKTTPLRRLMEAFAKRQGKEMDSLTFLYDGIEIQADQTPEDLDMEDNDIIEAHREQIGGMTGSTSHITILTLNINGLNSAIKRHRLASWIKSQDPSVCCIQETHLTCRDTHRLKIKGWRKIYQANGKQKKAGVAILVSDKTDFKPTKIKRDKEGHYIMVKGSIQQEELTILNIYAPNTGAPRFIKQVLSDLQRDLDSHTLIMGDFNTPLSTLDRSTRQKVNKDTQELNSALHQADLIDIYRTLHPKSTEYTFFSAPHHTYSKIDHIVGSKALLSKCKRTEIITNYLSDHSAIKLELRIKNLTQSRSTTWKLNNLLLNDYWVHNEMKAEIKMFFETNENKDTTYQNLWDAFKAVCRGKFIALNAYKRKQERSKIDTLTSQLKELEKQEQTHSKASRRQEITKIRAELKEIETQKTLQKINESRSWFFERINKIDRPLARLIKKKREKNQIDTIKNDKGDITTDPTEIQTTIREYYKHLYANKLENLEEMDTFLDTYTLPRLNQEEVESLNRPITGSEIVAIINSLPTKKSPGPDGFTAEFYQRYKEELVPFLLKLFQSIEKEGILPNSFYEASIILIPKPGRDTTKKENFRPISLMNIDAKILNKILANRIQQHIKKLIHHDQVGFIPGMQGWFNIRKSINVIQHINRAKDKNHMIISIDAEKAFDKIQQPFMLKTLNKLGIDGTYFKIIRAIYDKPTANIILNGQKLEAFPLKTGTRQGCPLSPLLFNIVLEVLARAIRQEKEIKGIQLGKEEVKLSLFADDMIVYLENPIVSAQNLLKLISNFSKVSGYKINVQKSQAFLYTNNRQTESQIMGELPFTIASKRIKYLGIQLTRDVKDLFKENYKPLLKEIKEETNKWKNIPCSWVGRINIVKMAILPKVIYRFNAIPIKLPMTFFTELEKTTLKFIWNQKRARIAKSILSQKNKAGGITLPDFKLYYKATVTKTAWYWYQNRDIDQWNRTEPSEIMPHIYNYLIFDKPEKNKQWGKDSLFNKWCWENWLAICRKLKLDPFLTPYTKINSRWIKDLNVKPKTIKTLEENLGITIQDIGVGKDFMSKTPKAMATKDKIDKWDLIKLKSFCTAKETTIRVNRQPTTWEKIFATYSSDKGLISRIYNELKQIYKKKTNNPIKKWAKDMNRHFSKEDIYAAKKHMKKCSSSLAIREMQIKTTMRYHLTPVRMAIIKKSGNNRCWRGCGEIGTLLHCWWDCKLVQPLWKSVWRFLRDLELEIPFDPAIPLLGIYPNEYKSCCYKDTCTRMFIAALFTIAKTWNQPKCPTMIDWIKKMWHIYTMEYYAAIKNDEFISFVGTWMKLETIILSKLSQEQKTKHRIFSLIGGN

Source Source

Source organism organism	Homo sapiens
Common name common_name	human
NCBI taxonomy ID ncbi_taxonomy_id	9606
Host organism host_organism	Trichoplusia ni

Entity 2 Entity 2 polymer

Description description	Target DNA strand 1
Molecular weight formula_weight	11424.3 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	B

TTAGTTGCTGAATTATTGGAAGTTTTGTTTTTTTTTT

Entity 3 Entity 3 polymer

Description description	Target DNA strand 2
Molecular weight formula_weight	9145.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	C

AAACAAAACTTCCAATAATTCAGCAACTAA

Entity 4 Entity 4 polymer

Description description	Template P(A)30 RNA
Molecular weight formula_weight	9831.2 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	D

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Entity 5 Entity 5 polymer

Description description	Target DNA strand 3
Molecular weight formula_weight	7900.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	E

TTTTTTTTTTTTTTTTTTTTTATAAA

Entity 6 Entity 6 polymer

Description description	Target DNA strand 4
Molecular weight formula_weight	5906.0 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	F

AAAAAAAAAAAAAAAAAAA

Entity 7 Entity 7 polymer

Description description	Unassigned Nucleic Acid
Molecular weight formula_weight	1207.9 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polydeoxyribonucleotide
Chain IDs strand_id	G

AAAA

Entity 8 Entity 8 non-polymer

Description description	MAGNESIUM ION
Molecular weight formula_weight	24.3 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 9 Entity 9 non-polymer

Description description	ZINC ION
Molecular weight formula_weight	65.4 kDa
Source method src_method	syn
Copy count entity_count	1

Entity 10 Entity 10 non-polymer

Description description	2',3'-DIDEOXY-THYMIDINE-5'-TRIPHOSPHATE
Molecular weight formula_weight	466.2 kDa
Source method src_method	syn
Copy count entity_count	1

▶

Unit-cell length a length_a	1.000 Å
Unit-cell length b length_b	1.000 Å
Unit-cell length c length_c	1.000 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	90.00 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	—

Space group space_group	P 1
Space-group number int_tables_number	1
Crystal system crystal_system	—

Resolution resolution	3.100 Å
Low-resolution limit resolution_low	154.710 Å
R factor r_factor	0.3186
R_work r_work	0.3186
R_free r_free	—

Resolution resolution	3.10 Å
Resolution测定Method resolution_method	—
颗粒数 num_particles	121941

Human LINE-1 ORF2p target-primed reverse transcription complex with EN domain resolved

1. Protein Identity and Related Structures Protein Identity & Related Structures

LINE-1 retrotransposable element ORF2 protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

LINE-1 retrotransposable element ORF2 protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

LINE-1 retrotransposable element ORF2 protein

State in the Current Structure

Other States of the Same Protein in the Database

Monomer

Homodimer

Homotetramer

Other homooligomers

Heteromeric or nucleic-acid complex

2. Structure Basics 2. Structure Basics

3. Official assembly/model SAXS Official SAXS Profiles

9hdr__assembly_1__model_1

9hdr__assembly_1__model_1 | I(q)

9hdr__assembly_1__model_1 | P(r) · Pending

4. Crystallography and Experiment 4. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

冷冻电镜 EM 3D

5. Entities and Polymers Entities & Polymers (10)

Entity 1 Entity 1 polymer

Polymer Polymer

Source Source

Entity 2 Entity 2 polymer

Polymer Polymer

Entity 3 Entity 3 polymer

Polymer Polymer

Entity 4 Entity 4 polymer

Polymer Polymer

Entity 5 Entity 5 polymer

Polymer Polymer

Entity 6 Entity 6 polymer

Polymer Polymer

Entity 7 Entity 7 polymer

Polymer Polymer

Entity 8 Entity 8 non-polymer

Entity 9 Entity 9 non-polymer

Entity 10 Entity 10 non-polymer

7. Citations (1)