5t7b

Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex

Method: X-RAY DIFFRACTION D_max: 99.0 Å Quality: GOOD

▼

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protein argonaute-2

Homo sapiens

State in the Current Structure

Assembly	Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Associated Components	Method and Experimental Conditions	Structure Quality
1	Protein–RNA Monomer Protein × 1 RNA 1 PDB declaration: dimeric（2） Consistent with all polymer counts	Chain A； UniProt 1–859	Not recorded	RNA (UVP)UAUAGAGCAAGAACACUGUU × 1 IPH PHENOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions：VAPOR DIFFUSION；290 K；100 mM Tris pH=9.0, 10% PEG 3350 (w/v), 8% 2-propanol (v/v), 0.12 M phenol	Resolution 2.53 Å R-free 0.238

Other States of the Same Protein in the Database

Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.

Other PDB	Difference from Current Entry 5T7B	Assembly / Oligomeric State	Construct	Mutations and Modifications	Ligands, Ions and Non-polymers	Method and Experimental Conditions	Structure Quality
10BE Human AGO2 bound to a miR-20a guide and a position 10-11 mismatched target Deposited 2026-01-09	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.02 Å
11GI Human Argonaute2 WT - guide(3 prime-amino) RNA in complex with a fully complementary target Deposited 2026-02-23	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D, S824A, S828D, S831D, S834A	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
11GJ Human Argonaute2 R315V/H316A - guide10U RNA in complex with a complementary target to position 19 Deposited 2026-02-23	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：R315V, H316A, S387D, S824A, S828D, S831D, S834A	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
11GK Human Argonaute2 R315V/H316A - guide RNA in complex with a fully complementary target (conformation 2) Deposited 2026-02-23	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：R315V, H316A, S387D, S824A, S828D, S831D, S834A	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.00 Å
3LUC Crystal structure of MID domain from hAGO2 Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 439–575（137 aa） Fragment：MID domain	Not recorded	PO4 PHOSPHATE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.69 Å R-free 0.209
3LUC Crystal structure of MID domain from hAGO2 Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 439–575（137 aa） Fragment：MID domain	Not recorded	PO4 PHOSPHATE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.69 Å R-free 0.209
3LUC Crystal structure of MID domain from hAGO2 Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 439–575（137 aa） Fragment：MID domain	Not recorded	PO4 PHOSPHATE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.69 Å R-free 0.209
3LUD Crystal structure of MID domain from hAGO2 in complex with AMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 439–575（137 aa） Fragment：MID domain	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1 PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.10 Å R-free 0.223
3LUD Crystal structure of MID domain from hAGO2 in complex with AMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 439–575（137 aa） Fragment：MID domain	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1 PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.10 Å R-free 0.223
3LUD Crystal structure of MID domain from hAGO2 in complex with AMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 439–575（137 aa） Fragment：MID domain	Not recorded	AMP ADENOSINE MONOPHOSPHATE × 1 PO4 PHOSPHATE ION × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.10 Å R-free 0.223
3LUG Crystal structure of MID domain from hAGO2 in complex with CMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 439–575（137 aa） Fragment：MID domain	Not recorded	PO4 PHOSPHATE ION × 1 C5P CYTIDINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP	Resolution 1.85 Å R-free 0.225
3LUG Crystal structure of MID domain from hAGO2 in complex with CMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 439–575（137 aa） Fragment：MID domain	Not recorded	PO4 PHOSPHATE ION × 2 C5P CYTIDINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP	Resolution 1.85 Å R-free 0.225
3LUG Crystal structure of MID domain from hAGO2 in complex with CMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 439–575（137 aa） Fragment：MID domain	Not recorded	PO4 PHOSPHATE ION × 2 C5P CYTIDINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP	Resolution 1.85 Å R-free 0.225
3LUH Crystal structure of MID domain from hAGO2 in complex with GMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 439–575（137 aa） Fragment：MID domain	Not recorded	5GP GUANOSINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.233
3LUH Crystal structure of MID domain from hAGO2 in complex with GMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 439–575（137 aa） Fragment：MID domain	Not recorded	5GP GUANOSINE-5'-MONOPHOSPHATE × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.233
3LUH Crystal structure of MID domain from hAGO2 in complex with GMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 439–575（137 aa） Fragment：MID domain	Not recorded	PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.233
3LUJ Crystal structure of MID domain from hAGO2 in complex with UMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 439–575（137 aa） Fragment：MID domain	Not recorded	U5P URIDINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.80 Å R-free 0.234
3LUJ Crystal structure of MID domain from hAGO2 in complex with UMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 439–575（137 aa） Fragment：MID domain	Not recorded	U5P URIDINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.80 Å R-free 0.234
3LUJ Crystal structure of MID domain from hAGO2 in complex with UMP Deposited 2010-02-17	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 439–575（137 aa） Fragment：MID domain	Not recorded	U5P URIDINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.80 Å R-free 0.234
3LUK Crystal structure of MID domain from hAGO2 Deposited 2010-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 439–575（137 aa） Fragment：MID domain	Non-standard monomer：Yes (specific site not provided by mmCIF)	PO4 PHOSPHATE ION × 2 GOL GLYCEROL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.70 Å R-free 0.232
3LUK Crystal structure of MID domain from hAGO2 Deposited 2010-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 439–575（137 aa） Fragment：MID domain	Non-standard monomer：Yes (specific site not provided by mmCIF)	PO4 PHOSPHATE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.70 Å R-free 0.232
3LUK Crystal structure of MID domain from hAGO2 Deposited 2010-02-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 439–575（137 aa） Fragment：MID domain	Non-standard monomer：Yes (specific site not provided by mmCIF)	PO4 PHOSPHATE ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4. Protein: 15 mg/mL, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 1.70 Å R-free 0.232
3QX8 Crystal structure of MID domain from hAGO2 in complex with m7GpppG Deposited 2011-03-01	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 439–575（137 aa） Fragment：unp residues 439-575	Not recorded	GTG 7-METHYL-GUANOSINE-5'-TRIPHOSPHATE-5'-GUANOSINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.30 Å R-free 0.279
3QX8 Crystal structure of MID domain from hAGO2 in complex with m7GpppG Deposited 2011-03-01	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 439–575（137 aa） Fragment：unp residues 439-575	Not recorded	GTG 7-METHYL-GUANOSINE-5'-TRIPHOSPHATE-5'-GUANOSINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.30 Å R-free 0.279
3QX8 Crystal structure of MID domain from hAGO2 in complex with m7GpppG Deposited 2011-03-01	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 439–575（137 aa） Fragment：unp residues 439-575	Not recorded	GTG 7-METHYL-GUANOSINE-5'-TRIPHOSPHATE-5'-GUANOSINE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4, pH 8.0, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.30 Å R-free 0.279
3QX9 Crystal structure of MID domain from hAGO2 in complex with ATP Deposited 2011-03-01	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 439–575（137 aa） Fragment：unp residues 439-575	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.250
3QX9 Crystal structure of MID domain from hAGO2 in complex with ATP Deposited 2011-03-01	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 439–575（137 aa） Fragment：unp residues 439-575	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.250
3QX9 Crystal structure of MID domain from hAGO2 in complex with ATP Deposited 2011-03-01	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 439–575（137 aa） Fragment：unp residues 439-575	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；277 K；0.1 M imidazole, 0.2 M NaCl, 0.46 M NaH2PO4, 1.84 M K2HPO4, VAPOR DIFFUSION, HANGING DROP, temperature 277K	Resolution 2.00 Å R-free 0.250
4F3T Human Argonaute-2 - miR-20a complex Deposited 2012-05-09	Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Not recorded	IPH PHENOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9；290 K；microseeding in 100 mM Tris pH=9.0, 10% PEG 3350 (w/v), 8% 2-propanol (v/v), 0.12 M phenol, VAPOR DIFFUSION, HANGING DROP, temperature 290K	Resolution 2.25 Å R-free 0.254
4OLA Crystal Structure of Human Argonaute2 Deposited 2014-01-23	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Mutation：S387D	IPH PHENOL × 1 IPA ISOPROPYL ALCOHOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9；293 K；16% PEG3350, 12% isopropanol, 0.1 M phenol, 0.1 M Tris, pH 9.0, VAPOR DIFFUSION, HANGING DROP, temperature 293.0K	Resolution 2.30 Å R-free 0.253
4OLB Crystal Structure of Human Argonaute2 Bound to Tryptophan Deposited 2014-01-23	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Mutation：S387D	TRP TRYPTOPHAN × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9；293 K；16% PEG3350, 12% isopropanol, saturated L-tryptophan, 0.1 M Tris, pH 9.0, VAPOR DIFFUSION, HANGING DROP, temperature 293K	Resolution 2.90 Å R-free 0.249
4W5N The Crystal Structure of Human Argonaute2 Bound to a Defined Guide RNA Deposited 2014-08-18	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Mutation：S387D	IPH PHENOL × 3 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；293 K；PEG, Tris, Isopropanol, Phenol, Magnesium	Resolution 2.90 Å R-free 0.253
4W5O The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-9 Deposited 2014-08-18	Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Not recorded	MG MAGNESIUM ION × 3 IPA ISOPROPYL ALCOHOL × 2 IPH PHENOL × 4 PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；293 K；PEG 3350, Tris, Isopropanol, Phenol, Magnesium	Resolution 1.80 Å R-free 0.197
4W5Q The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-8 Deposited 2014-08-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D	MG MAGNESIUM ION × 3 IPH PHENOL × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION；293 K；PEG 3350, Isopropanol, Phenol, Tris, Magnesium	Resolution 3.10 Å R-free 0.233
4W5R The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-8 (Long Target) Deposited 2014-08-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D	IPA ISOPROPYL ALCOHOL × 2 IPH PHENOL × 3 MG MAGNESIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG 3350, Isopropanol, Tris, Phenol, Magnesium	Resolution 2.50 Å R-free 0.234
4W5T The Crystal Structure of Human Argonaute2 Bound to a Guide and Target RNA Containing Seed Pairing from 2-7 Deposited 2014-08-18	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D	MG MAGNESIUM ION × 2 IPH PHENOL × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG 3350, Isopropanol, Phenol, Tris, Magnesium	Resolution 2.50 Å R-free 0.215
4Z4C Human Argonaute2 Bound to t1-C Target RNA Deposited 2015-04-02	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D	MG MAGNESIUM ION × 3 IPA ISOPROPYL ALCOHOL × 1 IPH PHENOL × 4 PO4 PHOSPHATE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG 3350, Tris, Isopropanol, Phenol, Magnesium	Resolution 2.30 Å R-free 0.219
4Z4D Human Argonaute2 Bound to t1-G Target RNA Deposited 2015-04-02	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D	MG MAGNESIUM ION × 3 IPH PHENOL × 4 IPA ISOPROPYL ALCOHOL × 5	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG 3350, Tris, Isopropanol, Phenol, Magnesium	Resolution 1.60 Å R-free 0.189
4Z4E Human Argonaute2 Bound to t1-U Target RNA Deposited 2015-04-02	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D	MG MAGNESIUM ION × 3 IPA ISOPROPYL ALCOHOL × 2 IPH PHENOL × 4 PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG 3350, Tris, Isopropanol, Phenol, Magnesium	Resolution 1.80 Å R-free 0.185
4Z4F Human Argonaute2 Bound to t1-DAP Target RNA Deposited 2015-04-02	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D	MG MAGNESIUM ION × 3 IPH PHENOL × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG 3350, Tris, Isopropanol, Phenol, Magnesium	Resolution 2.80 Å R-free 0.233
4Z4G Human Argonaute2 Bound to t1-Inosine Target RNA Deposited 2015-04-02	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D	MG MAGNESIUM ION × 3 IPH PHENOL × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG 3350, Tris, Isopropanol, Phenol, Magnesium	Resolution 2.70 Å R-free 0.224
4Z4H Human Argonaute2 A481T Mutant Bound to t1-A Target RNA Deposited 2015-04-02	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D A481T	MG MAGNESIUM ION × 3 IPH PHENOL × 4	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG 3350, Tris, Isopropanol, Phenol, Magnesium	Resolution 2.50 Å R-free 0.211
4Z4I Human Argonaute2 A481T Mutant Bound to t1-G Target RNA Deposited 2015-04-02	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D A481T	MG MAGNESIUM ION × 3 IPH PHENOL × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；PEG 3350, Tris, Isopropanol, Phenol, Magnesium	Resolution 2.80 Å R-free 0.233
5JS1 Human Argonaute2 Bound to an siRNA Deposited 2016-05-07	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Mutation：S387D	IPH PHENOL × 2 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9；293 K；16% PEG 3350, 50mM Phenol, 10% Isopropanol, 5mM Magnesium Chloride, 100mM Tris	Resolution 2.50 Å R-free 0.247
5JS2 Human Argonaute-2 Bound to a Modified siRNA Deposited 2016-05-07	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Mutation：S387D	IPH PHENOL × 2 PO4 PHOSPHATE ION × 1 MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9；293 K；12% PEG 3350, 75mM Phenol, 12% Isopropanol, 100mM Tris	Resolution 2.95 Å R-free 0.261
5KI6 Human Argonaute-2 bound to a guide RNA with a nucleobase modification at position 1 Deposited 2016-06-16	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Not recorded	IPH PHENOL × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 9；293 K；PEG 3350, Phenol, Tris, Spermine, Isopropanol	Resolution 2.15 Å R-free 0.270
5WEA Human Argonaute2 Helix-7 Mutant Deposited 2017-07-08	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Mutation：M364A, I365A, S387D	IPH PHENOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293 K；12% PEG 3350, 0.1 M phenol, 12% isopropanol, 0.1 M tris, pH 9.0	Resolution 3.12 Å R-free 0.282
6CBD Crystal Structure of Human Argonaute2 Bound to Three Tryptophans Deposited 2018-02-02	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D	TRP TRYPTOPHAN × 3 IPA ISOPROPYL ALCOHOL × 3 MG MAGNESIUM ION × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8.2；293 K；14% PEG 3350, 0.1 M Tris pH 8.2, 12% Isopropanol, 10 mM MgCl2, L-tryptophan to saturation	Resolution 2.20 Å R-free 0.215
6MDZ Human Argonaute2-miR-122 bound to a target RNA with two central mismatches (bu2) Deposited 2018-09-05	Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D, D669A, D824A, S828D, S831D, S834A	IPH PHENOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；10% PEG3350, 50mM Tris pH8, 20mM MgCl2, 75mM Phenol	Resolution 3.40 Å R-free 0.264
6MDZ Human Argonaute2-miR-122 bound to a target RNA with two central mismatches (bu2) Deposited 2018-09-05	Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 1–859（859 aa）	Mutation：S387D, D669A, D824A, S828D, S831D, S834A	IPH PHENOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；10% PEG3350, 50mM Tris pH8, 20mM MgCl2, 75mM Phenol	Resolution 3.40 Å R-free 0.264
6MFN Human Argonaute2-miR-27a bound to HSUR1 target RNA Deposited 2018-09-11	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：D669A, S387D, S824A, S828D, S831D, S834A	IPH PHENOL × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；10% PEG3350, 50 mM Tris, pH 8.0, 20 mM magnesium chloride, 75 mM phenol	Resolution 2.50 Å R-free 0.247
6MFR Human Argonaute2-miR-122 bound to a target RNA with three central mismatches (bu3) Deposited 2018-09-12	Different mutation/modification Different oligomeric state Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：D669A, S387D, S824A, S828D, s831D, S834A	IPH PHENOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；10% PEG3350, 50mM Tris pH8, 20mM MgCl2, 75mM Phenol	Resolution 3.60 Å R-free 0.283
6MFR Human Argonaute2-miR-122 bound to a target RNA with three central mismatches (bu3) Deposited 2018-09-12	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 1–859（859 aa）	Mutation：D669A, S387D, S824A, S828D, s831D, S834A	IPH PHENOL × 2 PO4 PHOSPHATE ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；10% PEG3350, 50mM Tris pH8, 20mM MgCl2, 75mM Phenol	Resolution 3.60 Å R-free 0.283
6N4O Human Argonaute2-miR-122 bound to a seed and supplementary paired target Deposited 2018-11-19	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：D669A, S387D, S824A, S828D, S831D, S834A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；26% MPD, 5% PEG 3350, 50 mM imidazole pH 8	Resolution 2.90 Å R-free 0.257
6NIT Human Argonaute2-miR-122 bound to a target RNA with four central mismatches (bu4) Deposited 2018-12-31	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：D669A, S387D, S824A, S828D, S831D, S834A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；10% PEG3350, 50mM Tris pH8, 20mM MgCl2, 75mM Phenol	Resolution 3.80 Å R-free 0.294
6NIT Human Argonaute2-miR-122 bound to a target RNA with four central mismatches (bu4) Deposited 2018-12-31	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain B 1–859（859 aa）	Mutation：D669A, S387D, S824A, S828D, S831D, S834A	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；10% PEG3350, 50mM Tris pH8, 20mM MgCl2, 75mM Phenol	Resolution 3.80 Å R-free 0.294
6RA4 Human ARGONAUTE-2 PAZ DOMAIN (214-347) IN COMPLEX WITH CGUGACUCU Deposited 2019-04-05	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 222–355（134 aa） Chain B 222–355（134 aa）	Not recorded	GOL GLYCEROL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7.6；292 K；Drop was a 1:1 mix of protein stock (9.4MG/ML HAGO2 PAZ [214 TO 347] IN 100MM POTASSIUM CHLORIDE, 10MM DTT, 5MM HEPES/KOH PH 7.6, WITH A 1.1-FOLD EXCESS OF OLIGONUCLEOTIDE ADDED FROM A 1.75MM STOCK SOLUTION IN 100MM POTASSIUM CHLORIDE, 10MM DTT, 5MM HEPES) and reservoir solution (0.2M sodium CHLORIDE 20% PEG 3,350)	Resolution 1.90 Å R-free 0.268
7C6B Crystal structure of Ago2 MID domain in complex with 6-(3-(2-carboxyethyl)phenyl)purine riboside monophosphate Deposited 2020-05-21	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 440–578（139 aa）	Not recorded	K2R 3-[3-[9-[(2R,3R,4S,5R)-3,4-bis(oxidanyl)-5-(phosphonooxymethyl)oxolan-2-yl]purin-6-yl]phenyl]propanoic acid × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；277.15 K；0.1M imidazole pH8.0, 0.2M NaCl, 0.46M NaH2PO4, 1.84M K2HPO4	Resolution 1.70 Å R-free 0.229
7C6B Crystal structure of Ago2 MID domain in complex with 6-(3-(2-carboxyethyl)phenyl)purine riboside monophosphate Deposited 2020-05-21	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 440–578（139 aa）	Not recorded	K2R 3-[3-[9-[(2R,3R,4S,5R)-3,4-bis(oxidanyl)-5-(phosphonooxymethyl)oxolan-2-yl]purin-6-yl]phenyl]propanoic acid × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；277.15 K；0.1M imidazole pH8.0, 0.2M NaCl, 0.46M NaH2PO4, 1.84M K2HPO4	Resolution 1.70 Å R-free 0.229
7C6B Crystal structure of Ago2 MID domain in complex with 6-(3-(2-carboxyethyl)phenyl)purine riboside monophosphate Deposited 2020-05-21	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 440–578（139 aa）	Not recorded	K2R 3-[3-[9-[(2R,3R,4S,5R)-3,4-bis(oxidanyl)-5-(phosphonooxymethyl)oxolan-2-yl]purin-6-yl]phenyl]propanoic acid × 1 PO4 PHOSPHATE ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；277.15 K；0.1M imidazole pH8.0, 0.2M NaCl, 0.46M NaH2PO4, 1.84M K2HPO4	Resolution 1.70 Å R-free 0.229
7D7U Crystal structure of Ago2 MID domain in complex with 8-Br-adenosin-5'-monophosphate Deposited 2020-10-06	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 440–578（139 aa） Fragment：MID domain	Not recorded	8BR 8-BROMO-ADENOSINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；277.15 K；0.1M imidazole pH8.0, 0.2M NaCl, 0.46M NaH2PO4, 1.84M K2HPO4	Resolution 2.00 Å R-free 0.247
7D7U Crystal structure of Ago2 MID domain in complex with 8-Br-adenosin-5'-monophosphate Deposited 2020-10-06	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 440–578（139 aa） Fragment：MID domain	Not recorded	8BR 8-BROMO-ADENOSINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；277.15 K；0.1M imidazole pH8.0, 0.2M NaCl, 0.46M NaH2PO4, 1.84M K2HPO4	Resolution 2.00 Å R-free 0.247
7D7U Crystal structure of Ago2 MID domain in complex with 8-Br-adenosin-5'-monophosphate Deposited 2020-10-06	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 440–578（139 aa） Fragment：MID domain	Not recorded	8BR 8-BROMO-ADENOSINE-5'-MONOPHOSPHATE × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 8；277.15 K；0.1M imidazole pH8.0, 0.2M NaCl, 0.46M NaH2PO4, 1.84M K2HPO4	Resolution 2.00 Å R-free 0.247
7KI3 Human Argonaute2:miR-122 bound to the HCV genotype 1a site-1 RNA Deposited 2020-10-22	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：S387D, S824A, S828D, S831D, S834A	BA BARIUM ION × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；PEG8000, barium chloride, Tris-HCl	Resolution 3.00 Å R-free 0.276
7KI3 Human Argonaute2:miR-122 bound to the HCV genotype 1a site-1 RNA Deposited 2020-10-22	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain D 1–859（859 aa）	Mutation：S387D, S824A, S828D, S831D, S834A	BA BARIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；PEG8000, barium chloride, Tris-HCl	Resolution 3.00 Å R-free 0.276
8D6J Human Ago2 bound to miR122(21nt) with PIWI loop swapped to AtAgo10 sequence Deposited 2022-06-06	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Not recorded	MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293.15 K；0.1M Tris 8, 0.01 MgCl2, 0.1M Phenol,15% PEG 3350, 10% Isoproponal.	Resolution 2.50 Å R-free 0.284
8D71 Human Ago2 bound to miR122(21nt) Deposited 2022-06-07	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Not recorded	MG MAGNESIUM ION × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；293.15 K；0.1M Tris 8, 0.01 MgCl2, 0.1M Phenol,15% PEG 3350, 10% Isoproponal	Resolution 2.50 Å R-free 0.280
8THQ Nonamer RNA bound to hAgo2-PAZ Deposited 2023-07-17	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Homooligomer；Protein × 2 PDB declaration: tetrameric	Chain A 227–352（126 aa） Fragment：PAZ domain Chain B 227–352（126 aa） Fragment：PAZ domain	Not recorded	No recorded non-water small molecule	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；pH 7；291 K；0.1 M HEPES pH 7.0, 30% v/v Jeffamine ED-2001	Resolution 2.41 Å R-free 0.284
9BEZ MID domain of human Argo2 bound to RNA Deposited 2024-04-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 440–575（136 aa） Chain B 440–575（136 aa） Chain C 440–575（136 aa）	Not recorded	A1ANT [(3~{S},4~{R},5~{R})-5-[5-methyl-2,4-bis(oxidanylidene)pyrimidin-1-yl]-4-oxidanyl-oxolan-3-yl] [oxidanyl(phosphonooxy)phosphoryl] hydrogen phosphate × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；291.15 K；Drops were equal volumes of 15 mg/ml protein and 2.1M DL-Malic acid. The reservoir was 2.1M DL-Malic acid. Using MRC drop plates.	Resolution 1.90 Å R-free 0.288
9BF0 MID domain of human Argo2 bound to UTP Deposited 2024-04-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 442–575（134 aa） Chain B 442–575（134 aa） Chain C 442–575（134 aa）	Not recorded	UTP URIDINE 5'-TRIPHOSPHATE × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；291.15 K；drop was 1:1 15 mg/ml protein with RNA: 1.4 M Sodium citrate tribasic dihydrate, 0.1 M HEPES pH 7.5	Resolution 1.78 Å R-free 0.234
9BF2 MID domain of Ago2 bound to UMP Deposited 2024-04-16	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein homooligomer Homooligomer；Protein × 3 PDB declaration: trimeric	Chain A 440–575（136 aa） Chain B 440–575（136 aa） Chain C 440–575（136 aa）	Not recorded	U URIDINE-5'-MONOPHOSPHATE × 3	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, SITTING DROP；291.15 K；Drop was 1:1 15 mg/ml MID-UMP and 1.4M sodium citrate tribasic dihydrate, 0.1M HEPES pH7.5	Resolution 1.59 Å R-free 0.187
9CMP Structure of human Argonaute2-guide-target complex in a fully paired, slicing-competent conformation Deposited 2024-07-15	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 2–859（858 aa）	Mutation：D669A	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 7.5 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.30 Å
9DHX human Argonaute2 R315V/H316A - guide RNA in complex with a fully complementary target Deposited 2024-09-04	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：R315V, H316A, S387D, S824A, S828D, S831D, S834A	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.10 Å
9K6P Cryo-EM Structure of hAGO2D669A-siRNA-target (12-nt) Deposited 2024-10-22	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：D669A	No recorded non-water small molecule	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 3.20 Å
9K6Q "Cryo-EM Structure of hAGO2D669A-siRNA-target (14-nt, sesqui-lobed) Deposited 2024-10-22	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：D669A	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.70 Å
9K6R Cryo-EM Structure of hAGO2D669A-siRNA-target (14-nt, uni-lobed) Deposited 2024-10-22	Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 20–859（840 aa）	Mutation：D669A	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.70 Å
9K6S Cryo-EM Structure of hAGO2D669A-siRNA-target (19-nt) Deposited 2024-10-22	Different mutation/modification Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Mutation：D669A	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
9K6T Cryo-EM Structure of hAGO2D669A-siRNA-target (21-nt) Deposited 2024-10-22	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Not recorded	MG MAGNESIUM ION × 1	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.80 Å
9LMZ hAGO2-MID in complex with a chemical modified uridine monophosphate Deposited 2025-01-20	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 440–574（135 aa）	Not recorded	A1EY1 [(2R,3S,4R,5R)-5-[2,4-bis(oxidanylidene)thieno[2,3-d]pyrimidin-1-yl]-3,4-bis(oxidanyl)oxolan-2-yl]methyl dihydrogen phosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；290 K；0.25M Ammonium sulfate 0.1M Sodium cacodylate trihydrate pH 6.5 30% w/v Polyethylene glycol 8,000	Resolution 1.80 Å R-free 0.206
9LMZ hAGO2-MID in complex with a chemical modified uridine monophosphate Deposited 2025-01-20	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 440–574（135 aa）	Not recorded	A1EY1 [(2R,3S,4R,5R)-5-[2,4-bis(oxidanylidene)thieno[2,3-d]pyrimidin-1-yl]-3,4-bis(oxidanyl)oxolan-2-yl]methyl dihydrogen phosphate × 1 ECC (4S)-4-amino-5-hydroxypentanamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；290 K；0.25M Ammonium sulfate 0.1M Sodium cacodylate trihydrate pH 6.5 30% w/v Polyethylene glycol 8,000	Resolution 1.80 Å R-free 0.206
9LMZ hAGO2-MID in complex with a chemical modified uridine monophosphate Deposited 2025-01-20	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 440–574（135 aa）	Not recorded	A1EY1 [(2R,3S,4R,5R)-5-[2,4-bis(oxidanylidene)thieno[2,3-d]pyrimidin-1-yl]-3,4-bis(oxidanyl)oxolan-2-yl]methyl dihydrogen phosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；290 K；0.25M Ammonium sulfate 0.1M Sodium cacodylate trihydrate pH 6.5 30% w/v Polyethylene glycol 8,000	Resolution 1.80 Å R-free 0.206
9LSN hAGO2-MID in complex with a chemical modified uridine monophosphate Deposited 2025-02-04	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 440–574（135 aa）	Not recorded	A1EL7 [(2R,3S,4R,5R)-5-[2,4-bis(oxidanylidene)thieno[3,2-d]pyrimidin-1-yl]-3,4-bis(oxidanyl)oxolan-2-yl]methyl dihydrogen phosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；290 K；0.25M Ammonium sulfate 0.1M Sodium cacodylate trihydrate pH 6.5 30% w/v Polyethylene glycol 8,000	Resolution 1.75 Å R-free 0.218
9LSN hAGO2-MID in complex with a chemical modified uridine monophosphate Deposited 2025-02-04	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 440–574（135 aa）	Not recorded	A1EL7 [(2R,3S,4R,5R)-5-[2,4-bis(oxidanylidene)thieno[3,2-d]pyrimidin-1-yl]-3,4-bis(oxidanyl)oxolan-2-yl]methyl dihydrogen phosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；290 K；0.25M Ammonium sulfate 0.1M Sodium cacodylate trihydrate pH 6.5 30% w/v Polyethylene glycol 8,000	Resolution 1.75 Å R-free 0.218
9LSN hAGO2-MID in complex with a chemical modified uridine monophosphate Deposited 2025-02-04	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 440–574（135 aa）	Not recorded	A1EL7 [(2R,3S,4R,5R)-5-[2,4-bis(oxidanylidene)thieno[3,2-d]pyrimidin-1-yl]-3,4-bis(oxidanyl)oxolan-2-yl]methyl dihydrogen phosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；290 K；0.25M Ammonium sulfate 0.1M Sodium cacodylate trihydrate pH 6.5 30% w/v Polyethylene glycol 8,000	Resolution 1.75 Å R-free 0.218
9LSO hAGO2-MID in complex with a chemical modified uridine monophosphate Deposited 2025-02-04	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain A 440–574（135 aa）	Not recorded	A1EL8 [(2R,3S,4R,5R)-5-[2,4-bis(oxidanylidene)thieno[3,4-d]pyrimidin-1-yl]-3,4-bis(oxidanyl)oxolan-2-yl]methyl dihydrogen phosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；290 K；0.25M Ammonium sulfate 0.1M Sodium cacodylate trihydrate pH 6.5 30% w/v Polyethylene glycol 8,000	Resolution 2.13 Å R-free 0.241
9LSO hAGO2-MID in complex with a chemical modified uridine monophosphate Deposited 2025-02-04	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 2 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain B 440–574（135 aa）	Not recorded	A1EL8 [(2R,3S,4R,5R)-5-[2,4-bis(oxidanylidene)thieno[3,4-d]pyrimidin-1-yl]-3,4-bis(oxidanyl)oxolan-2-yl]methyl dihydrogen phosphate × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；290 K；0.25M Ammonium sulfate 0.1M Sodium cacodylate trihydrate pH 6.5 30% w/v Polyethylene glycol 8,000	Resolution 2.13 Å R-free 0.241
9LSO hAGO2-MID in complex with a chemical modified uridine monophosphate Deposited 2025-02-04	Different construct Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 3 Protein monomer Monomer；Protein × 1 PDB declaration: monomeric	Chain C 440–574（135 aa）	Not recorded	A1EL8 [(2R,3S,4R,5R)-5-[2,4-bis(oxidanylidene)thieno[3,4-d]pyrimidin-1-yl]-3,4-bis(oxidanyl)oxolan-2-yl]methyl dihydrogen phosphate × 1 ECC (4S)-4-amino-5-hydroxypentanamide × 1	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；290 K；0.25M Ammonium sulfate 0.1M Sodium cacodylate trihydrate pH 6.5 30% w/v Polyethylene glycol 8,000	Resolution 2.13 Å R-free 0.241
9OBD Crystal structure of human Argonaute2 in complex with a fully modified siRNA with a 5'-phenylpropargyl phosphate Deposited 2025-04-22	Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Mutation：S387D S824A S828D S831D S834A	MG MAGNESIUM ION × 1 IPH PHENOL × 3 IPA ISOPROPYL ALCOHOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；PEG3350, Tris-HCl pH8, 2-propanol, phenol	Resolution 2.02 Å R-free 0.267
9OBE Crystal structure of human Argonaute2 in complex with a fully modified siRNA with a 5'-phenylpropyl phosphate Deposited 2025-04-22	Different ligand/ion Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Not recorded	MG MAGNESIUM ION × 1 IPH PHENOL × 2	X-RAY DIFFRACTION X-ray crystallization conditions VAPOR DIFFUSION, HANGING DROP；pH 8；293 K；PEG3350, Tris-HCl pH8, 2-propanol, phenol	Resolution 2.30 Å R-free 0.252
9RWZ ZSWIM8-CUL3 complex bound to AGO2-miR-7-CYRANO Deposited 2025-07-10	Different construct Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 9 PDB declaration: 11-meric	Chain A 2–859（858 aa）	Not recorded	ZN ZINC ION × 2	ELECTRON MICROSCOPY cryo-EM buffer pH 7.8；25 mM HEPES, 50 mM NaCl, 1 mM TCEP, pH 7.8 cryo-EM vitrification conditions Cryogen ETHANE-PROPANE	Resolution 3.10 Å
9W5I AGO maturation complex (AMC): AGO2-miRNA duplex in complex with Hsp90 beta and co-chaperone p23 Deposited 2025-08-01	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Heteromer；Protein × 4 PDB declaration: hexameric	Chain D 1–859（859 aa）	Not recorded	ATP ADENOSINE-5'-TRIPHOSPHATE × 2 MG MAGNESIUM ION × 3	ELECTRON MICROSCOPY cryo-EM buffer pH 8 cryo-EM vitrification conditions Cryogen ETHANE	Resolution 2.63 Å
9YM9 Structure of AGO2 primary RISC (pri-RISC) Deposited 2025-10-09	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.79 Å
9YMA Structure of AGO2 vise-RISC Deposited 2025-10-09	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.87 Å
9YMB Structure of AGO2 wedging RISC (wedg-RISC) Deposited 2025-10-09	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.77 Å
9YMC Structure of AGO2 passenger-ejecting RISC (ej-RISC) Deposited 2025-10-09	Different oligomeric state Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: trimeric	Chain A 1–859（859 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.28 Å
9YMD Structure of AGO2 mature RISC (mat-RISC) Deposited 2025-10-09	Different ligand/ion Different experimental method Different experimental conditions Different structure-quality metrics	Assembly 1 Protein–RNA Monomer；Protein × 1 PDB declaration: dimeric	Chain A 1–859（859 aa）	Not recorded	No recorded non-water small molecule	ELECTRON MICROSCOPY mmCIF provides none of the parsed conditions	Resolution 3.45 Å

66 other PDB entries and 96 assemblies. Open the comparison page and filter oligomeric states

View Construct and Data Evidence

UniProt name	AGO2_HUMAN
Isoform	—
PDB entities	2
Chains and sequence ranges	Author chain A； PDBConstruct 3–861； UniProt 1–859

The page prioritizes protein identity, the current assembly, associated components, oligomeric state and cross-PDB links. Chain mapping and sequence ranges are retained as data evidence. Internal IDs, import timestamps and assembly operation expressions are maintenance fields and are not shown here.

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

Download Download SAXS (.dat) P(r) (.pr.out) CIF

▼

2. Structure Basics 2. Structure Basics

Entry ID entry_id	5t7b
Deposition date deposition_date	2016-09-02
Structure title title	Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex
Keywords keywords	RNAi, HYDROLASE-RNA complex; HYDROLASE/RNA
Experimental Method method	X-RAY DIFFRACTION

▼

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

Radius of gyration Rg (Guinier) rg_guinier	30.68 Å
Radius of gyration Rg (electron density) rg_electron	30.22 Å
Forward intensity I(0) i0	149379000.00
Molecular weight molecular_weight	95388.0 kDa
Excluded volume excluded_volume	118880 Å³
Envelope volume envelope_volume	152230 Å³
Hydration-shell volume shell_volume	41711 Å³
Envelope diameter envelope_diameter	106.2 Å
Shell Rg shell_rg	37.61 Å
Envelope Rg envelope_rg	30.12 Å
Shape Rg shape_rg	30.21 Å
Total Rg total_rg	30.90 Å
Total atoms total_atoms	6705
Residues n_residues	812
Spherical-harmonic order n_harmonics	20
q range q_range	— – 0.5000 Å⁻¹
Data points n_points	101
Shell type shell_type	directional
Solvent electron density solvent_density	0.3340 e/Å³
Shell contrast contrast_shell	0.0300 e/Å³
CRYSOL version crysol_version	4.1.3

▼

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

Maximum dimension Dmax dmax	99.0 Å
Rg (real space) rg_real	30.60 Å
Rg uncertainty (real space) rg_real_error	0.54 Å
I(0) (real space) i0_real	1.4940e+08
I(0) uncertainty (real space) i0_real_error	2.2750e+06
Rg (reciprocal space) rg_reciprocal	30.64 Å
I(0) (reciprocal space) i0_reciprocal	149400000.0000
Solution quality estimate total_estimate	0.8991
Solution quality rating solution_quality	GOOD a GOOD solution
P(r) peaks n_peaks	1
Primary peak position r_peak_primary	36.2 Å
Skewness Skewness skewness	0.268
Kurtosis Kurtosis kurtosis	-0.433
Angular range angular_range	— – 0.2600 Å⁻¹
Current regularization parameter α current_alpha	0.0001
Highest regularization parameter α highest_alpha	35680000.0000
Real-space data points n_real_points	53
GNOM version gnom_version	4.1.3
Quality Criteria quality_criteria	AN1: 0.000; Oscil: 0.907; Stabil: 1.000; Sysdev: 1.000; Positv: 1.000; Valcen: 0.999; Smooth: 0.963

▶

5. Crystallography and Experiment 5. Crystallography & Experiment

▶

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Description description	RNA (UVP)UAUAGAGCAAGAACACUGUU
Molecular weight formula_weight	6733.1 kDa
Source method src_method	syn
Copy count entity_count	1

Polymer Polymer

Polymer type type	polyribonucleotide
Chain IDs strand_id	R
Atom count atom_count	6714

XUAUAGAGCAAGAACACUGUU

Entity 2 Entity 2 polymer

Description description	Protein argonaute-2
Molecular weight formula_weight	97476.3 kDa
EC 编号 ec_number	3.1.26.-
Source method src_method	man
Copy count entity_count	1

Polymer Polymer

Polymer type type	polypeptide(L)
Chain IDs strand_id	A

GAMYSGAGPALAPPAPPPPIQGYAFKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGANVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRNGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA

来源 Source

来源生物 organism	Homo sapiens
通用名 common_name	Human
NCBI Class编号 ncbi_taxonomy_id	9606
宿主生物 host_organism	Spodoptera frugiperda

Entity 3 Entity 3 non-polymer

Description description	PHENOL
Molecular weight formula_weight	94.1 kDa
Source method src_method	syn
Copy count entity_count	2

Entity 4 Entity 4 water

Description description	water
Molecular weight formula_weight	18.0 kDa
Source method src_method	nat
Copy count entity_count	9

▼

7. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

Domain ID domain_id	5t7bA02
Class class	2 — Mainly Beta
Architecture architecture	170 — Beta Complex
Topology topology	260 — paz domain
Homologous superfamily homologous superfamily	10 — paz domain

Domain ID domain_id	5t7bA03
Class class	3 — Alpha Beta
Architecture architecture	40 — 3-Layer(aba) Sandwich
Topology topology	50 — Rossmann fold
Homologous superfamily homologous superfamily	2300 — Response regulator

Domain ID domain_id	5t7bA04
Class class	3 — Alpha Beta
Architecture architecture	30 — 2-Layer Sandwich
Topology topology	420 — Nucleotidyltransferase; domain 5
Homologous superfamily homologous superfamily	10 — Ribonuclease H-like superfamily/Ribonuclease H

▶

8. Citations (1)

▶

Unit-cell length a length_a	63.207 Å
Unit-cell length b length_b	108.306 Å
Unit-cell length c length_c	68.821 Å
Unit-cell angle α angle_alpha	90.00 °
Unit-cell angle β angle_beta	106.62 °
Unit-cell angle γ angle_gamma	90.00 °
Molecules per unit cell Z z_pdb	2

Space group space_group	P 1 21 1
Space-group number int_tables_number	4
Crystal system crystal_system	—

Resolution resolution	2.529 Å
Low-resolution limit resolution_low	65.946 Å
R factor r_factor	0.1957
R_work r_work	0.1935
R_free r_free	0.2383

fit	/app/data/saxs_computation/t7/5t7b/5t7b.fit
pddf	/app/data/pr_computation/t7/5t7b/5t7b.pr.out
profile	/app/data/saxs_computation/t7/5t7b/5t7b.dat

Argonaute-2 - 5'-(E)-vinylphosphonate 2'-O-methyl-uridine modified mrTTR guide RNA complex

1. Protein Identity and Related Structures Protein Identity & Related Structures

Protein argonaute-2

State in the Current Structure

Other States of the Same Protein in the Database

SAXS scattering curve SAXS Profile

P(r) Distance Distribution P(r) Distribution

2. Structure Basics 2. Structure Basics

3. SAXS Parameters (CRYSOL theoretical calculation) 3. SAXS Parameters (CRYSOL)

4. P(r) Distance Distribution (GNOM inversion) 4. P(r) Analysis (GNOM)

5. Crystallography and Experiment 5. Crystallography & Experiment

Unit cell Unit Cell

Symmetry Symmetry

Refinement Refinement

Diffraction experiment Diffraction

6. Entities and Polymers Entities & Polymers (4)

Entity 1 Entity 1 polymer

Polymer Polymer

Entity 2 Entity 2 polymer

Polymer Polymer

来源 Source

Entity 3 Entity 3 non-polymer

Entity 4 Entity 4 water

7. Fold Classification (SCOP + CATH) 3 domains

CATH v4.4 (3 domains)

8. Citations (1)

9. Files and Curves (10)

Files (7)

Curves (3)