Replication initiation protein
Escherichia coli K-12
State in the Current Structure
| Assembly | Oligomeric State | Construct | Mutations and Modifications | Ligands, Ions and Associated Components | Method and Experimental Conditions | Structure Quality |
|---|---|---|---|---|---|---|
| 1 | Protein–DNA Monomer Protein × 1 DNA 2 PDB declaration: trimeric(3) Consistent with all polymer counts | Chain C; UniProt 1–251 | Mutation:R118P | ;DNA (5'-D(CP*CP*CP*GP*GP*AP*CP*CP*TP*GP*TP*GP*AP*CP*AP*AP*AP*TP*TP*GP*CP*CP*CP*TP*CP*AP*GP*AP*CP*GP*GP*A)-3') ; × 1 ;DNA (5'-D(GP*CP*CP*GP*TP*CP*TP*GP*AP*GP*GP*GP*CP*AP*AP*TP*TP*TP*GP*TP*CP*AP*CP*AP*GP*GP*TP*CP*CP*GP*GP*A)-3') ; × 1 CA CALCIUM ION × 2 | X-RAY DIFFRACTION X-ray crystallization conditions:VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;400 mM MgCl2, 24% PEG 400, and 80 mM Tris HCl | Resolution 3.10 Å R-free 0.255 |
Other States of the Same Protein in the Database
Each row is a biological assembly of the same UniProt protein in another PDB entry. The “Difference from current entry” column identifies evidence-level differences; no tag means the currently parsed fields agree.
| Other PDB | Difference from Current Entry 8D8M | Assembly / Oligomeric State | Construct | Mutations and Modifications | Ligands, Ions and Non-polymers | Method and Experimental Conditions | Structure Quality |
|---|---|---|---|---|---|---|---|
| 1REP CRYSTAL STRUCTURE OF REPLICATION INITIATOR PROTEIN REPE54 OF MINI-F PLASMID COMPLEXED WITH AN ITERON DNA Deposited 1999-04-29 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, HANGING DROP;pH 8;12 % PEG 400, 200 MM MGCL2, 100 MM TRIS-HCL, PH8.0, VAPOR DIFFUSION, HANGING DROP
|
Resolution 2.60 Å R-free 0.274 |
| 2Z9O Crystal structure of the dimeric form of RepE in complex with the repE operator DNA Deposited 2007-09-21 | Different construct Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Homooligomer;Protein × 2 PDB declaration: tetrameric |
Chain A
2–251(250 aa)
Chain B
2–251(250 aa)
|
Not recorded | No recorded non-water small molecule |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 7.2;277 K;10% PEG 4000, 200mM Sodium Chloride, 5mM Samarium Chloride, 100mM HEPES-NaOH, pH 7.2, VAPOR DIFFUSION, SITTING DROP, temperature 277K
|
Resolution 3.14 Å R-free 0.313 |
| 7RVA Updated Crystal Structure of Replication Initiator Protein REPE54. Deposited 2021-08-18 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | NA SODIUM ION × 1 MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;300 mM MgCl2, 18% PEG 400, and 100 mM Tris HCl
|
Resolution 1.89 Å R-free 0.249 |
| 7U6K Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence. Deposited 2022-03-04 | Different ligand/ion Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 7 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;400 mM MgCl2, 24% PEG 400, and 80 mM Tris HCl
|
Resolution 2.38 Å R-free 0.224 |
| 7U7O Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional T-A rich sequence. Deposited 2022-03-07 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;300 mM MgCl2, 28% PEG 400, and 80 mM Tris HCl
|
Resolution 2.97 Å R-free 0.258 |
| 7UFX Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and scaffold-insert duplexes (21mer and 10mer) containing the cognate REPE54 sequence and an additional G-C rich sequence, respectively. Deposited 2022-03-23 | Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 6 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;180 mM MgCl2, 20% PEG 400, and 100 mM Tris HCl
|
Resolution 2.80 Å R-free 0.226 |
| 7UOG Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence. Deposited 2022-04-12 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 5 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;200 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
|
Resolution 2.63 Å R-free 0.221 |
| 7UR0 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and scaffold-insert duplexes (21mer and 10mer) containing the cognate REPE54 sequence and an additional T-A rich sequence, respectively. Deposited 2022-04-20 | Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;120 mM MgCl2, 20% PEG 400, 100 mM Tris HCl pH 8.0
|
Resolution 3.30 Å R-free 0.275 |
| 7UV6 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and scaffold duplex (21mer) containing the cognate REPE54 sequence and an insert duplex (10mer) with guest TAMRA-labelled thymine and G-C rich sequence. Deposited 2022-04-29 | Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 5 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;300 mM MgCl2, 15% PEG 400, and 100 mM Tris HCl
|
Resolution 2.72 Å R-free 0.224 |
| 7UV7 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and scaffold duplex (21mer) containing the cognate REPE54 sequence and an insert duplex (10mer) with guest TAMRA-labelled thymine and T-A rich sequence. Deposited 2022-04-29 | Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;200 mM MgCl2, 30% PEG 400, 100 mM Tris HCl pH 8.0
|
Resolution 3.02 Å R-free 0.269 |
| 7UXY Isoreticular, interpenetrating co-crystal of protein variant Replication Initiator Protein REPE54 (L53G,Q54G,E55G) and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence. Deposited 2022-05-06 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P,L53G,Q54G,E55G | MG MAGNESIUM ION × 8 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;350 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
|
Resolution 3.15 Å R-free 0.264 |
| 8AAN The nucleoprotein complex of Rep protein with iteron containing dsDNA and DUE ssDNA. Deposited 2022-07-01 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: tetrameric |
Chain A
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;291.15 K;10% w/v PEG 20 000, 20% v/v PEG MME 550 0.02M of each carboxylic acid (0.2 M sodium formate, 0.2M ammonium acetate, 0.2M trisodium citrate, 0.2M sodium potassium L-tartrate, 0.2M sodium oxamate), 0.1M MES/imidazole pH 6.5.
|
Resolution 2.19 Å R-free 0.233 |
| 8AC8 The nucleoprotein complex of Rep protein with DUE ssDNA Deposited 2022-07-05 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: dimeric |
Chain C
1–251(251 aa)
|
Not recorded | No recorded non-water small molecule |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;291.15 K;PEG 8000, ethylene glycol, HEPES, halogens
|
Resolution 1.60 Å R-free 0.243 |
| 8AC8 The nucleoprotein complex of Rep protein with DUE ssDNA Deposited 2022-07-05 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 2 Protein–DNA Monomer;Protein × 1 PDB declaration: dimeric |
Chain A
1–251(251 aa)
|
Not recorded | No recorded non-water small molecule |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;291.15 K;PEG 8000, ethylene glycol, HEPES, halogens
|
Resolution 1.60 Å R-free 0.243 |
| 8D86 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence co-crystallized with a guest small molecule, netropsin. Deposited 2022-06-07 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 5 NT NETROPSIN × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;300 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
|
Resolution 3.12 Å R-free 0.234 |
| 8TIP Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with blunt ends and 5' terminal phosphates. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 5 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;400 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
|
Resolution 2.79 Å R-free 0.240 |
| 8TIQ Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with blunt ends and 3' terminal phosphates. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 6 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
|
Resolution 2.45 Å R-free 0.267 |
| 8TIR Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 1 sticky bases and 5' terminal phosphates. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 4 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;350 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
|
Resolution 3.11 Å R-free 0.242 |
| 8TIS Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 1 sticky bases and 3' terminal phosphates. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 4 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
|
Resolution 2.54 Å R-free 0.278 |
| 8TIT Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and no terminal phosphates. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 6 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;450 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
|
Resolution 2.84 Å R-free 0.240 |
| 8TIU Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and 3' terminal phosphates. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 5 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;400 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
|
Resolution 3.90 Å R-free 0.231 |
| 8TIV Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with blunt ends and 5' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
|
Resolution 3.35 Å R-free 0.260 |
| 8TIW Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with blunt ends and 3' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
|
Resolution 3.11 Å R-free 0.212 |
| 8TIX Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 1 sticky bases and 5' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 4 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;350 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
|
Resolution 2.91 Å R-free 0.228 |
| 8TIY Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 1 sticky bases and 3' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 3 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;350 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
|
Resolution 3.11 Å R-free 0.231 |
| 8TIZ Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and no terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 4 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;450 mM MgCl2, 25% PEG 400, and 100 mM Tris HCl
|
Resolution 3.11 Å R-free 0.217 |
| 8TJ0 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and 5' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 | Different ligand/ion Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;400 mM MgCl2, 24% PEG 400, and 80 mM Tris HCl
|
Resolution 3.24 Å R-free 0.225 |
| 8TJ1 Isoreticular, interpenetrating co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and an additional G-C rich sequence with 2 sticky base overhangs and 3' terminal phosphates and crosslinked with EDC. Deposited 2023-07-20 | Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:R118P | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 8;298 K;400 mM MgCl2, 30% PEG 400, and 100 mM Tris HCl
|
Resolution 3.15 Å R-free 0.225 |
| 9NB0 Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional expansion sequence Deposited 2025-02-13 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;500mM Lithium Sulfate, 20mM Magnesium Acetate, 50mM MES
|
Resolution 3.20 Å R-free 0.197 |
| 9NCR Isoreticular, Porous co-crystal of Replication Initiator Protein REPE54 and symmetrical expanded duplex (31mer) containing the cognate REPE54 sequence and additional G/C rich expansion sequence Deposited 2025-02-17 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;1M lithium sulfate, 30mM Magnesium acetate, 50mM MES
|
Resolution 3.24 Å R-free 0.231 |
| 9YZA Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Mutation:L53G, Q54G, E55G | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;10 mM Magnesium acetate, 1300 mM Lithium sulfate, 50 mM MES pH 6.5
|
Resolution 3.05 Å R-free 0.309 |
| 9YZB Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;10 mM Magnesium acetate, 1.6M Lithium sulfate, 50 mM MES pH 6.5
|
Resolution 4.13 Å R-free 0.253 |
| 9YZC Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 4 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;80 mM Magnesium acetate, 1.2 M Lithium sulfate, 50 mM MES pH 6.5
|
Resolution 3.16 Å R-free 0.299 |
| 9YZD Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;30 mM Magnesium acetate, 1.3 M Lithium sulfate, 50 mM MES pH 6.5
|
Resolution 3.09 Å R-free 0.265 |
| 9YZE Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;20 mM Magnesium acetate, 300 mM Lithium sulfate, 50 mM MES pH 6.5
|
Resolution 4.07 Å R-free 0.276 |
| 9YZF Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;50 mM Magnesium acetate, 1.1 M Lithium sulfate, 50 mM MES pH 6.5
|
Resolution 3.07 Å R-free 0.241 |
| 9YZG Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;20 mM Magnesium acetate, 1.4 M Lithium sulfate, 50 mM MES pH 6.5
|
Resolution 3.09 Å R-free 0.301 |
| 9YZI Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 4 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;50 mM Magnesium acetate, 1.6 M Lithium sulfate, 50 mM MES pH 6.5
|
Resolution 4.00 Å R-free 0.322 |
| 9YZJ Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 4 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;30 mM Magnesium acetate, 1.7 M Lithium sulfate, 50 mM MES pH 6.5
|
Resolution 2.97 Å R-free 0.292 |
| 9YZK Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA Deposited 2025-10-30 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;298 K;60mM Magnesium acetate, 1.6M Lithium sulfate, 50mM MES pH 6.5
|
Resolution 5.10 Å R-free 0.304 |
| 9YZL Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 3 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;30mM Magnesium Acetate, 1.2M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 15mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain
|
Resolution 3.02 Å R-free 0.294 |
| 9YZM Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 3 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;30mM magnesium acetate, 1.1M lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain.
|
Resolution 3.07 Å R-free 0.269 |
| 9YZN Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 3 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;40mM Magnesium acetate, 1.4M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 25mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain.
|
Resolution 3.16 Å R-free 0.283 |
| 9YZO Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 3 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;20mM magnesium acetate, 1.7M lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain.
|
Resolution 2.96 Å R-free 0.312 |
| 9YZP Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 2 PDB declaration: tetrameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;40mM Magnesium acetate, 1.5M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 45mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 40 micromolar Ultrabithorax homeodomain.
|
Resolution 3.67 Å R-free 0.295 |
| 9YZQ Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Insufficient information Heteromer;Protein × 2 PDB declaration: tetrameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;40mM Magnesium acetate, 1.4M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 45mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 22 micromolar engrailed homeodomain-enhanced Green fluorescent protein fusion
|
Resolution 3.75 Å R-free 0.338 |
| 9YZR Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 3 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;30mM magnesium acetate, 900mM Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 48mg/mL EDC overnight, and then looped into a solution of 35mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 80 micromolar Ultrabithorax homeodomain.
|
Resolution 3.39 Å R-free 0.298 |
| 9YZS Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 3 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;30mM magnesium acetate, 800mM lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 47.5mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 30 micromolar Even-skipped homeodomain.
|
Resolution 3.08 Å R-free 0.291 |
| 9YZT Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 3 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;30mM Magnesium acetate, 1.1M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 47.5mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 23 micromolar Even-skipped homeodomain.
|
Resolution 3.30 Å R-free 0.292 |
| 9YZU Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor Deposited 2025-10-30 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 4 PDB declaration: hexameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;50mM magnesium acetate, 1.8M lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 50mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 33 micromolar bZip
|
Resolution 3.05 Å R-free 0.246 |
| 9Z08 Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing separate insert strand with sequence GACGGTAATT Deposited 2025-10-31 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: pentameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 2 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;10 mM Magnesium acetate, 1.3 M Lithium sulfate, 50 mM sodium cacodylate pH 6.5
|
Resolution 4.22 Å R-free 0.254 |
| 9Z1A Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC Deposited 2025-11-03 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;80 mM Magnesium Acetate, 1.2 M Lithium Sulfate, 50 mM MES pH 6.5
|
Resolution 3.10 Å R-free 0.335 |
| 9Z1B Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCGCGCAGGC, crystal soaked in alternate solvent prior to diffraction Deposited 2025-11-03 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | CA CALCIUM ION × 2 K POTASSIUM ION × 3 MG MAGNESIUM ION × 6 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;50mM Magnesium acetate, 1.6M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 40 mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride.
|
Resolution 3.88 Å R-free 0.308 |
| 9Z1C Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC, crystal soaked in alternate solvent prior to diffraction Deposited 2025-11-03 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | K POTASSIUM ION × 3 MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;50mM Magnesium acetate, 1.5M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 33mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride.
|
Resolution 3.04 Å R-free 0.325 |
| 9Z1D Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence GCTTGATGAG, crystal soaked in alternate solvent prior to diffraction Deposited 2025-11-03 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 1 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;25mM Magnesium acetate, 800mM Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 50mg/mL EDC overnight, and then looped into a solution of 10mM HEPES pH 6.5, 50mM sodium chloride, 2.5 mM magnesium chloride, 800mM lithium sulfate, 15mM magnesium acetate, 25mM MES pH 6.5, and 80 micromolar Ultrabithorax homeodomain.
|
Resolution 3.06 Å R-free 0.318 |
| 9Z44 Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA and loaded with C-clamp domain Deposited 2025-11-08 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 2 PDB declaration: tetrameric |
Chain C
1–251(251 aa)
|
Not recorded | No recorded non-water small molecule |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;60mM magnesium acetate, 1.8M lithium sulfate, 50mM MES pH 6.5.The crystal was crosslinked with 50 mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 90 micromolar C-clamp
|
Resolution 7.20 Å R-free 0.345 |
| 9Z4E Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT and loaded with mutated Bzip region of GCN4 transcription factor Deposited 2025-11-10 | Different mutation/modification Different oligomeric state Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Heteromer;Protein × 4 PDB declaration: hexameric |
Chain C
1–251(251 aa)
|
Not recorded | MG MAGNESIUM ION × 3 |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;50mM magnesium acetate, 1.6M Lithium sulfate, 50mM MES pH 6.5. The crystal was crosslinked with 47.5 mg/mL EDC overnight, and then looped into a solution of 50mM potassium chloride, 4mM calcium chloride, 10% glycerol, and 10mM Tris hydrochloride for 1 hour. The drop was then supplemented with 100 micromolar bZip
|
Resolution 3.63 Å R-free 0.285 |
| 9Z55 Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CATGAGTCAT Deposited 2025-11-11 | Different mutation/modification Different ligand/ion Different experimental conditions Different structure-quality metrics | Assembly 1 Protein–DNA Monomer;Protein × 1 PDB declaration: trimeric |
Chain C
1–251(251 aa)
|
Not recorded | No recorded non-water small molecule |
X-RAY DIFFRACTION
X-ray crystallization conditions
VAPOR DIFFUSION, SITTING DROP;pH 6.5;298 K;40mM magnesium acetate, 1.8M lithium sulfate, 50mM MES pH 6.5
|
Resolution 3.94 Å R-free 0.316 |
57 other PDB entries and 58 assemblies. Open the comparison page and filter oligomeric states
View Construct and Data Evidence
| UniProt name | REPE1_ECOLI |
| Isoform | — |
| PDB entities | 3 |
| Chains and sequence ranges | Author chain C; PDBConstruct 13–263; UniProt 1–251 |