«
‹
1
...
5085
5086
5087
5088
5089
5090
5091
5092
5093
...
5099
›
»
Page 5089 of 5099 · 254917 entries
Go to
| PDB ID | Title | Rg (Å) | Dmax (Å) | Experimental Method | Quality Rating |
|---|---|---|---|---|---|
| 9yuy | Structure of the Plasmodium falciparum 20S proteasome in complex with a beta5-selective covalent syringolin analogue inhibitor. | 60.7 | 174.5 | ELECTRON MICROSCOPY | GOOD |
| 9yuz | Structure of the human 20S proteasome in complex with a beta5-selective covalent syringolin analogue inhibitor. | 59.5 | 193.5 | ELECTRON MICROSCOPY | REASONABLE |
| 9yv3 | Crystal Structure of a ternary complex of Saccharomyces cerevisiae Sec14 with a small molecule inhibitor and phosphatidylcholine | 20.2 | 62.0 | X-RAY DIFFRACTION | EXCELLENT |
| 9yv4 | Crystal structure of the human DCAF1 WDR domain in complex with OICR-41109 | — | — | X-RAY DIFFRACTION | — |
| 9yv5 | Crystal structure of cytochrome P450 enzyme Bmp7 | 23.7 | 71.2 | X-RAY DIFFRACTION | EXCELLENT |
| 9yvv | Cocrystallized structure of Bmp7 in complex with 2,4-dibromophenol | 23.6 | 72.5 | X-RAY DIFFRACTION | EXCELLENT |
| 9yw2 | Complex structure of human p97 bound to Faf1 and Ufd1 (NTD focused) | 24.8 | 90.6 | ELECTRON MICROSCOPY | GOOD |
| 9ywi | Crystal structure of a Glyceraldehyde-3-phosphate dehydrogenase from Bordetella pertussis (monoclinic P form) | 50.0 | 165.1 | X-RAY DIFFRACTION | GOOD |
| 9ywn | Protein Structure of the First Glycoside Hydrolase Family 30, Subfamily 12 Endoxylanase | 42.3 | 131.1 | X-RAY DIFFRACTION | GOOD |
| 9yx0 | Structure of the 3-methylcrotonyl-coenzyme A carboxylase from Mycobacterium smegmatis | 62.4 | 203.4 | ELECTRON MICROSCOPY | REASONABLE |
| 9yx1 | Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis | 68.5 | 213.8 | ELECTRON MICROSCOPY | GOOD |
| 9yx2 | Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis with ATP, bicarbonate, and propionyl-CoA | 71.4 | 210.3 | ELECTRON MICROSCOPY | GOOD |
| 9yx4 | Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis with ATP, bicarbonate, arachidoyl-CoA, and propionyl-CoA | 71.5 | 209.3 | ELECTRON MICROSCOPY | GOOD |
| 9yx5 | Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis with MSMEG_0435-MSMEG_0436 bound | 70.9 | 258.6 | ELECTRON MICROSCOPY | REASONABLE |
| 9yxd | Crystal structure of recombinant human follicle stimulating hormone in complex with an anti-FSH alpha Fab | 36.3 | 123.5 | X-RAY DIFFRACTION | REASONABLE |
| 9yxm | 10-23 DNAzyme in complex with T7 RNA Polymerase | 36.9 | 133.0 | ELECTRON MICROSCOPY | GOOD |
| 9yxq | Cryo-EM structure of the Xenopus laevis mitotic centromere-associated kinesin (MCAK) bound to the paclitaxel-stabilized microtubule | 77.9 | 216.0 | ELECTRON MICROSCOPY | EXCELLENT |
| 9yxv | Cryo-EM structure of the core region of cIL-U1A-Fab1R-PGA1-sfFab quaternary complex at 2.9 A resolution | 32.9 | 107.9 | ELECTRON MICROSCOPY | GOOD |
| 9yxy | Crystal structure of EEPD1 EEP domain dimer at pH 5.5 | 29.6 | 96.8 | X-RAY DIFFRACTION | GOOD |
| 9yy0 | IGHV4-34 germline-reverted antibody pre166 | 25.1 | 75.8 | X-RAY DIFFRACTION | EXCELLENT |
| 9yy4 | Importin a2 in complex with Lone Star virus non-structural S (NSs) NLS peptide | 28.5 | 98.9 | X-RAY DIFFRACTION | GOOD |
| 9yy9 | Macrophage Migration Inhibitory Factor 1 from Heligmosomoides polygyrus | 15.9 | 53.3 | X-RAY DIFFRACTION | GOOD |
| 9yya | Macrophage Migration Inhibitory Factor 1 from Necator Americanus | 38.9 | 132.0 | X-RAY DIFFRACTION | GOOD |
| 9yys | Crystal Structure of the Poly(Hexamethylene Adipamide) (Nylon66) Hydrolase Nyl10 at Cryo Temperature | 36.6 | 119.0 | X-RAY DIFFRACTION | GOOD |
| 9yyu | SARS-CoV-2 spike trimer in the early fusion intermediate conformation bound to the VN01H1 Fab (Fab local refinement) | 35.5 | 128.3 | ELECTRON MICROSCOPY | REASONABLE |
| 9yyv | SARS-CoV-2 spike trimer in the early fusion intermediate conformation bound to the VN01H1 Fab (S2 local refinement) | 44.1 | 167.9 | ELECTRON MICROSCOPY | REASONABLE |
| 9yz4 | Neisseria gonorrhoeae Transferrin Binding Protein A in complex with Transferrin Binding Protein B and transferrin (iron bound in N lobe only) | 49.1 | 165.1 | ELECTRON MICROSCOPY | GOOD |
| 9yz5 | human FicD bound with farnesyl pyrophosphate | 30.6 | 96.4 | X-RAY DIFFRACTION | EXCELLENT |
| 9yza | Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA | 27.0 | 103.3 | X-RAY DIFFRACTION | GOOD |
| 9yzb | Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA | 27.5 | 107.7 | X-RAY DIFFRACTION | GOOD |
| 9yzc | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG | 28.2 | 100.8 | X-RAY DIFFRACTION | GOOD |
| 9yzd | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC | 28.1 | 101.3 | X-RAY DIFFRACTION | GOOD |
| 9yze | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG | 28.3 | 101.1 | X-RAY DIFFRACTION | GOOD |
| 9yzf | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG | 27.9 | 99.5 | X-RAY DIFFRACTION | GOOD |
| 9yzg | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA | 27.7 | 99.0 | X-RAY DIFFRACTION | REASONABLE |
| 9yzi | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA | 27.9 | 99.7 | X-RAY DIFFRACTION | GOOD |
| 9yzj | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG | 27.6 | 98.7 | X-RAY DIFFRACTION | GOOD |
| 9yzk | Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA | 34.0 | 89.5 | X-RAY DIFFRACTION | REASONABLE |
| 9yzl | Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization | 27.8 | 99.4 | X-RAY DIFFRACTION | GOOD |
| 9yzm | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain | 28.9 | 99.7 | X-RAY DIFFRACTION | REASONABLE |
| 9yzn | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain | 29.1 | 99.6 | X-RAY DIFFRACTION | GOOD |
| 9yzo | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain | 28.8 | 98.5 | X-RAY DIFFRACTION | GOOD |
| 9yzp | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain | 28.2 | 100.8 | X-RAY DIFFRACTION | REASONABLE |
| 9yzq | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion | 28.0 | 100.8 | X-RAY DIFFRACTION | REASONABLE |
| 9yzr | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain | 28.3 | 100.5 | X-RAY DIFFRACTION | GOOD |
| 9yzs | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain | 29.0 | 101.0 | X-RAY DIFFRACTION | REASONABLE |
| 9yzt | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain | 27.9 | 99.8 | X-RAY DIFFRACTION | GOOD |
| 9yzu | Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor | 29.7 | 102.4 | X-RAY DIFFRACTION | GOOD |
| 9yzv | Joint Xray/Neutron structure of human DJ-1 at room temperature | 18.2 | 54.0 | — | GOOD |
| 9yzw | Joint Xray/Neutron structure of Escherichia coli YajL at room temperature | 22.9 | 71.7 | — | GOOD |