PDB ID Title official curves Structure unit Experimental Method
9yuy Structure of the Plasmodium falciparum 20S proteasome in complex with a beta5-selective covalent syringolin analogue inhibitor. 1 1 ELECTRON MICROSCOPY
9yuz Structure of the human 20S proteasome in complex with a beta5-selective covalent syringolin analogue inhibitor. 1 1 ELECTRON MICROSCOPY
9yv3 Crystal Structure of a ternary complex of Saccharomyces cerevisiae Sec14 with a small molecule inhibitor and phosphatidylcholine 1 1 X-RAY DIFFRACTION
9yv4 Crystal structure of the human DCAF1 WDR domain in complex with OICR-41109 1 2 X-RAY DIFFRACTION
9yv5 Crystal structure of cytochrome P450 enzyme Bmp7 1 1 X-RAY DIFFRACTION
9yvv Cocrystallized structure of Bmp7 in complex with 2,4-dibromophenol 1 1 X-RAY DIFFRACTION
9yw2 Complex structure of human p97 bound to Faf1 and Ufd1 (NTD focused) 1 1 ELECTRON MICROSCOPY
9ywi Crystal structure of a Glyceraldehyde-3-phosphate dehydrogenase from Bordetella pertussis (monoclinic P form) 2 2 X-RAY DIFFRACTION
9ywn Protein Structure of the First Glycoside Hydrolase Family 30, Subfamily 12 Endoxylanase 6 6 X-RAY DIFFRACTION
9yx0 Structure of the 3-methylcrotonyl-coenzyme A carboxylase from Mycobacterium smegmatis 1 1 ELECTRON MICROSCOPY
9yx1 Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis 1 1 ELECTRON MICROSCOPY
9yx2 Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis with ATP, bicarbonate, and propionyl-CoA 1 1 ELECTRON MICROSCOPY
9yx4 Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis with ATP, bicarbonate, arachidoyl-CoA, and propionyl-CoA 1 1 ELECTRON MICROSCOPY
9yx5 Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis with MSMEG_0435-MSMEG_0436 bound 1 1 ELECTRON MICROSCOPY
9yxd Crystal structure of recombinant human follicle stimulating hormone in complex with an anti-FSH alpha Fab 1 1 X-RAY DIFFRACTION
9yxm 10-23 DNAzyme in complex with T7 RNA Polymerase 1 1 ELECTRON MICROSCOPY
9yxq Cryo-EM structure of the Xenopus laevis mitotic centromere-associated kinesin (MCAK) bound to the paclitaxel-stabilized microtubule 1 1 ELECTRON MICROSCOPY
9yxv Cryo-EM structure of the core region of cIL-U1A-Fab1R-PGA1-sfFab quaternary complex at 2.9 A resolution 1 1 ELECTRON MICROSCOPY
9yxy Crystal structure of EEPD1 EEP domain dimer at pH 5.5 1 1 X-RAY DIFFRACTION
9yy0 IGHV4-34 germline-reverted antibody pre166 1 1 X-RAY DIFFRACTION
9yy4 Importin a2 in complex with Lone Star virus non-structural S (NSs) NLS peptide 1 1 X-RAY DIFFRACTION
9yy9 Macrophage Migration Inhibitory Factor 1 from Heligmosomoides polygyrus 1 1 X-RAY DIFFRACTION
9yya Macrophage Migration Inhibitory Factor 1 from Necator Americanus 4 4 X-RAY DIFFRACTION
9yys Crystal Structure of the Poly(Hexamethylene Adipamide) (Nylon66) Hydrolase Nyl10 at Cryo Temperature 1 1 X-RAY DIFFRACTION
9yyu SARS-CoV-2 spike trimer in the early fusion intermediate conformation bound to the VN01H1 Fab (Fab local refinement) 1 1 ELECTRON MICROSCOPY
9yyv SARS-CoV-2 spike trimer in the early fusion intermediate conformation bound to the VN01H1 Fab (S2 local refinement) 1 1 ELECTRON MICROSCOPY
9yz4 Neisseria gonorrhoeae Transferrin Binding Protein A in complex with Transferrin Binding Protein B and transferrin (iron bound in N lobe only) 1 1 ELECTRON MICROSCOPY
9yz5 human FicD bound with farnesyl pyrophosphate 1 1 X-RAY DIFFRACTION
9yza Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA 1 1 X-RAY DIFFRACTION
9yzb Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA 1 1 X-RAY DIFFRACTION
9yzc Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG 1 1 X-RAY DIFFRACTION
9yzd Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC 1 1 X-RAY DIFFRACTION
9yze Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG 1 1 X-RAY DIFFRACTION
9yzf Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG 1 1 X-RAY DIFFRACTION
9yzg Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA 1 1 X-RAY DIFFRACTION
9yzi Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA 1 1 X-RAY DIFFRACTION
9yzj Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG 1 1 X-RAY DIFFRACTION
9yzk Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA 1 1 X-RAY DIFFRACTION
9yzl Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization 1 1 X-RAY DIFFRACTION
9yzm Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain 1 1 X-RAY DIFFRACTION
9yzn Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain 1 1 X-RAY DIFFRACTION
9yzo Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain 1 1 X-RAY DIFFRACTION
9yzp Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain 1 1 X-RAY DIFFRACTION
9yzq Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion 1 1 X-RAY DIFFRACTION
9yzr Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain 1 1 X-RAY DIFFRACTION
9yzs Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain 1 1 X-RAY DIFFRACTION
9yzt Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain 1 1 X-RAY DIFFRACTION
9yzu Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor 1 1 X-RAY DIFFRACTION
9yzv Joint Xray/Neutron structure of human DJ-1 at room temperature 1 1 —
9yzw Joint Xray/Neutron structure of Escherichia coli YajL at room temperature 1 1 —