PDB ID Title Rg (Å) Dmax (Å) Experimental Method Quality Rating
9yuy Structure of the Plasmodium falciparum 20S proteasome in complex with a beta5-selective covalent syringolin analogue inhibitor. 60.7 174.5 ELECTRON MICROSCOPY GOOD
9yuz Structure of the human 20S proteasome in complex with a beta5-selective covalent syringolin analogue inhibitor. 59.5 193.5 ELECTRON MICROSCOPY REASONABLE
9yv3 Crystal Structure of a ternary complex of Saccharomyces cerevisiae Sec14 with a small molecule inhibitor and phosphatidylcholine 20.2 62.0 X-RAY DIFFRACTION EXCELLENT
9yv4 Crystal structure of the human DCAF1 WDR domain in complex with OICR-41109 X-RAY DIFFRACTION
9yv5 Crystal structure of cytochrome P450 enzyme Bmp7 23.7 71.2 X-RAY DIFFRACTION EXCELLENT
9yvv Cocrystallized structure of Bmp7 in complex with 2,4-dibromophenol 23.6 72.5 X-RAY DIFFRACTION EXCELLENT
9yw2 Complex structure of human p97 bound to Faf1 and Ufd1 (NTD focused) 24.8 90.6 ELECTRON MICROSCOPY GOOD
9ywi Crystal structure of a Glyceraldehyde-3-phosphate dehydrogenase from Bordetella pertussis (monoclinic P form) 50.0 165.1 X-RAY DIFFRACTION GOOD
9ywn Protein Structure of the First Glycoside Hydrolase Family 30, Subfamily 12 Endoxylanase 42.3 131.1 X-RAY DIFFRACTION GOOD
9yx0 Structure of the 3-methylcrotonyl-coenzyme A carboxylase from Mycobacterium smegmatis 62.4 203.4 ELECTRON MICROSCOPY REASONABLE
9yx1 Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis 68.5 213.8 ELECTRON MICROSCOPY GOOD
9yx2 Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis with ATP, bicarbonate, and propionyl-CoA 71.4 210.3 ELECTRON MICROSCOPY GOOD
9yx4 Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis with ATP, bicarbonate, arachidoyl-CoA, and propionyl-CoA 71.5 209.3 ELECTRON MICROSCOPY GOOD
9yx5 Structure of the long chain acyl-CoA carboxylase complex from Mycobacterium smegmatis with MSMEG_0435-MSMEG_0436 bound 70.9 258.6 ELECTRON MICROSCOPY REASONABLE
9yxd Crystal structure of recombinant human follicle stimulating hormone in complex with an anti-FSH alpha Fab 36.3 123.5 X-RAY DIFFRACTION REASONABLE
9yxm 10-23 DNAzyme in complex with T7 RNA Polymerase 36.9 133.0 ELECTRON MICROSCOPY GOOD
9yxq Cryo-EM structure of the Xenopus laevis mitotic centromere-associated kinesin (MCAK) bound to the paclitaxel-stabilized microtubule 77.9 216.0 ELECTRON MICROSCOPY EXCELLENT
9yxv Cryo-EM structure of the core region of cIL-U1A-Fab1R-PGA1-sfFab quaternary complex at 2.9 A resolution 32.9 107.9 ELECTRON MICROSCOPY GOOD
9yxy Crystal structure of EEPD1 EEP domain dimer at pH 5.5 29.6 96.8 X-RAY DIFFRACTION GOOD
9yy0 IGHV4-34 germline-reverted antibody pre166 25.1 75.8 X-RAY DIFFRACTION EXCELLENT
9yy4 Importin a2 in complex with Lone Star virus non-structural S (NSs) NLS peptide 28.5 98.9 X-RAY DIFFRACTION GOOD
9yy9 Macrophage Migration Inhibitory Factor 1 from Heligmosomoides polygyrus 15.9 53.3 X-RAY DIFFRACTION GOOD
9yya Macrophage Migration Inhibitory Factor 1 from Necator Americanus 38.9 132.0 X-RAY DIFFRACTION GOOD
9yys Crystal Structure of the Poly(Hexamethylene Adipamide) (Nylon66) Hydrolase Nyl10 at Cryo Temperature 36.6 119.0 X-RAY DIFFRACTION GOOD
9yyu SARS-CoV-2 spike trimer in the early fusion intermediate conformation bound to the VN01H1 Fab (Fab local refinement) 35.5 128.3 ELECTRON MICROSCOPY REASONABLE
9yyv SARS-CoV-2 spike trimer in the early fusion intermediate conformation bound to the VN01H1 Fab (S2 local refinement) 44.1 167.9 ELECTRON MICROSCOPY REASONABLE
9yz4 Neisseria gonorrhoeae Transferrin Binding Protein A in complex with Transferrin Binding Protein B and transferrin (iron bound in N lobe only) 49.1 165.1 ELECTRON MICROSCOPY GOOD
9yz5 human FicD bound with farnesyl pyrophosphate 30.6 96.4 X-RAY DIFFRACTION EXCELLENT
9yza Isoreticular co-crystal 1 of protein variant Replication Initiator Protein REPE54 (L53G, Q54G, E55G) with symmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA 27.0 103.3 X-RAY DIFFRACTION GOOD
9yzb Isoreticular co-crystal 1 with symmetrical expanded duplex (31mer) containing insert sequence ACGGTAATTA 27.5 107.7 X-RAY DIFFRACTION GOOD
9yzc Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGCGCGCGCG 28.2 100.8 X-RAY DIFFRACTION GOOD
9yzd Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC 28.1 101.3 X-RAY DIFFRACTION GOOD
9yze Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG 28.3 101.1 X-RAY DIFFRACTION GOOD
9yzf Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence AATTAGGCCG 27.9 99.5 X-RAY DIFFRACTION GOOD
9yzg Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA 27.7 99.0 X-RAY DIFFRACTION REASONABLE
9yzi Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CCCGGCCGGA 27.9 99.7 X-RAY DIFFRACTION GOOD
9yzj Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CGTAATTAGG 27.6 98.7 X-RAY DIFFRACTION GOOD
9yzk Isoreticular co-crystal 1 with symmetrical expanded duplex (42mer) containing insert sequence ACCCTTCTATGACCTACTCCA 34.0 89.5 X-RAY DIFFRACTION REASONABLE
9yzl Isoreticular co-crystal of Replication Initiator Protein REPE54 and asymmetrical expanded duplex (31mer) containing the cognate REPE54 sequence, and additional T-A rich sequence with 5' terminal phosphates. Two copies of Even-skipped homeodomain loaded post-crystallization 27.8 99.4 X-RAY DIFFRACTION GOOD
9yzm Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence CTAATTAGGC and loaded with Even-skipped homeodomain 28.9 99.7 X-RAY DIFFRACTION REASONABLE
9yzn Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain 29.1 99.6 X-RAY DIFFRACTION GOOD
9yzo Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Even-skipped homeodomain 28.8 98.5 X-RAY DIFFRACTION GOOD
9yzp Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with ultrabithorax homeodomain 28.2 100.8 X-RAY DIFFRACTION REASONABLE
9yzq Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TGATGAGCAG and loaded with Engrailed homeodomain enhanced Green fluorescent protein fusion 28.0 100.8 X-RAY DIFFRACTION REASONABLE
9yzr Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with ultrabithorax homeodomain 28.3 100.5 X-RAY DIFFRACTION GOOD
9yzs Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Even-skipped homeodomain 29.0 101.0 X-RAY DIFFRACTION REASONABLE
9yzt Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence TAATTAGGCCG and loaded with Antennapedia homeodomain 27.9 99.8 X-RAY DIFFRACTION GOOD
9yzu Isoreticular co-crystal 1 with asymmetrical expanded duplex (31mer) containing insert sequence ATGAGTCATA and loaded with mutated Bzip region of GCN4 transcription factor 29.7 102.4 X-RAY DIFFRACTION GOOD
9yzv Joint Xray/Neutron structure of human DJ-1 at room temperature 18.2 54.0 GOOD
9yzw Joint Xray/Neutron structure of Escherichia coli YajL at room temperature 22.9 71.7 GOOD